EMAIL THIS PAGE TO A FRIEND

PPAPDC2

phosphatidic acid phosphatase type 2 domain containing 2

126 Gene Product Result for
Synonyms: PDP1 PSDP bA6J24.6
UniProtKB ID: Q8IY26, B3KY05, Q5JVJ6, Q8NCK9
Gene ID:
Mouse(74411) phosphatidic acid phosphatase type 2 domain containing 2
Rat(619549) phosphatidic acid phosphatase type 2 domain containing 2
domestic guinea pig(101789041) phosphatidic acid phosphatase type 2 domain containing 2
naked mole-rat(101714098) phosphatidic acid phosphatase type 2 domain containing 2
cow(541021) phosphatidic acid phosphatase type 2 domain containing 2
Zebrafish(553687) phosphatidic acid phosphatase type 2 domain containing 2
chicken(424383) phosphatidic acid phosphatase type 2 domain containing 2
dog(609595) phosphatidic acid phosphatase type 2 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203453 Rosetta Predictions human pricing
NM_001034854 Rosetta Predictions rat pricing
NM_028922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057413 predicted 1347 154.00
2 SASI_Hs01_00057414 predicted 1274 154.00
3 SASI_Hs01_00057415 predicted 1319 154.00
4 SASI_Hs01_00057416 predicted 1273 154.00
5 SASI_Hs02_00373383 predicted 991 154.00
6 SASI_Hs01_00057417 predicted 1322 154.00
7 SASI_Hs01_00057418 predicted 1249 154.00
8 SASI_Hs01_00057419 predicted 1295 154.00
9 SASI_Hs01_00057421 predicted 957 154.00
10 SASI_Hs01_00057422 predicted 480 154.00
11 SASI_Hs01_00057420 predicted 1255 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056944 predicted 963 154.00
2 SASI_Rn01_00056945 predicted 1011 154.00
3 SASI_Rn01_00056946 predicted 800 154.00
4 SASI_Rn01_00056947 predicted 812 154.00
5 SASI_Rn01_00056948 predicted 784 154.00
6 SASI_Rn02_00204043 predicted 1006 154.00
7 SASI_Rn01_00056949 predicted 619 154.00
8 SASI_Rn01_00056950 predicted 887 154.00
9 SASI_Rn01_00056952 predicted 867 154.00
10 SASI_Rn02_00204044 predicted 708 154.00
11 SASI_Rn01_00056951 predicted 536 154.00
12 SASI_Rn01_00056953 predicted 486 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101846 predicted 1152 154.00
2 SASI_Mm01_00101847 predicted 341 154.00
3 SASI_Mm01_00101848 predicted 827 154.00
4 SASI_Mm01_00101849 predicted 1105 154.00
5 SASI_Mm01_00101850 predicted 819 154.00
6 SASI_Mm01_00101851 predicted 915 154.00
7 SASI_Mm01_00101852 predicted 982 154.00
8 SASI_Mm01_00101853 predicted 555 154.00
9 SASI_Mm01_00101855 predicted 792 154.00
10 SASI_Mm02_00334619 predicted 390 154.00
11 SASI_Mm01_00101854 predicted 965 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203453
VALIDATED
PPAPDC2 MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2 domain containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-2017s21c1
Sequence:CCGGACATAAGCTTTCTCGTATATACTCGAGTATATACGAGAAAGCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-611s21c1
Sequence:CCGGTGCTGGTGGCCTTGATCAAAGCTCGAGCTTTGATCAAGGCCACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-841s1c1
Sequence:CCGGCGGCACAATGTCACCGACGTACTCGAGTACGTCGGTGACATTGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-732s1c1
Sequence:CCGGCGCCCTGATGTCGAGGTTCATCTCGAGATGAACCTCGACATCAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-889s1c1
Sequence:CCGGCAGTACAGCATCGTGGACTATCTCGAGATAGTCCACGATGCTGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203453.2-2680s1c1
Sequence:CCGGGCCAGATATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-658s1c1
Sequence:CCGGCACAACCAGATGGACATGTTTCTCGAGAAACATGTCCATCTGGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-964s21c1
Sequence:CCGGTGACACCATCTCATTGATTATCTCGAGATAATCAATGAGATGGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-352s21c1
Sequence:CCGGATGGACTTGAACCCGTCCTTCCTCGAGGAAGGACGGGTTCAAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203453.2-1012s21c1
Sequence:CCGGATTCGATGATGTCAACCTAAACTCGAGTTTAGGTTGACATCATCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-890s21c1
Sequence:CCGGAGTACAGCATCGTGGACTATTCTCGAGAATAGTCCACGATGCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-846s21c1
Sequence:CCGGCAATGTCACCGACGTAGCTTTCTCGAGAAAGCTACGTCGGTGACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-688s21c1
Sequence:CCGGTCGGTGGACAAGTACTCCTTCCTCGAGGAAGGAGTACTTGTCCACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203453
VALIDATED
PPAPDC2 MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2 domain containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-2017s21c1
Sequence:CCGGACATAAGCTTTCTCGTATATACTCGAGTATATACGAGAAAGCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-611s21c1
Sequence:CCGGTGCTGGTGGCCTTGATCAAAGCTCGAGCTTTGATCAAGGCCACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-841s1c1
Sequence:CCGGCGGCACAATGTCACCGACGTACTCGAGTACGTCGGTGACATTGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-732s1c1
Sequence:CCGGCGCCCTGATGTCGAGGTTCATCTCGAGATGAACCTCGACATCAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-889s1c1
Sequence:CCGGCAGTACAGCATCGTGGACTATCTCGAGATAGTCCACGATGCTGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203453.2-2680s1c1
Sequence:CCGGGCCAGATATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-658s1c1
Sequence:CCGGCACAACCAGATGGACATGTTTCTCGAGAAACATGTCCATCTGGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-964s21c1
Sequence:CCGGTGACACCATCTCATTGATTATCTCGAGATAATCAATGAGATGGTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-352s21c1
Sequence:CCGGATGGACTTGAACCCGTCCTTCCTCGAGGAAGGACGGGTTCAAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203453.2-1012s21c1
Sequence:CCGGATTCGATGATGTCAACCTAAACTCGAGTTTAGGTTGACATCATCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-890s21c1
Sequence:CCGGAGTACAGCATCGTGGACTATTCTCGAGAATAGTCCACGATGCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-846s21c1
Sequence:CCGGCAATGTCACCGACGTAGCTTTCTCGAGAAAGCTACGTCGGTGACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-688s21c1
Sequence:CCGGTCGGTGGACAAGTACTCCTTCCTCGAGGAAGGAGTACTTGTCCACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203453
VALIDATED
PPAPDC2 MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2 domain containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-2017s21c1
Sequence:CCGGACATAAGCTTTCTCGTATATACTCGAGTATATACGAGAAAGCTTATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000244969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-611s21c1
Sequence:CCGGTGCTGGTGGCCTTGATCAAAGCTCGAGCTTTGATCAAGGCCACCAGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-841s1c1
Sequence:CCGGCGGCACAATGTCACCGACGTACTCGAGTACGTCGGTGACATTGTGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-732s1c1
Sequence:CCGGCGCCCTGATGTCGAGGTTCATCTCGAGATGAACCTCGACATCAGGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-889s1c1
Sequence:CCGGCAGTACAGCATCGTGGACTATCTCGAGATAGTCCACGATGCTGTACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203453.2-2680s1c1
Sequence:CCGGGCCAGATATTTGGAAGCAAATCTCGAGATTTGCTTCCAAATATCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203453.2-658s1c1
Sequence:CCGGCACAACCAGATGGACATGTTTCTCGAGAAACATGTCCATCTGGTTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000244972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-964s21c1
Sequence:CCGGTGACACCATCTCATTGATTATCTCGAGATAATCAATGAGATGGTGTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-352s21c1
Sequence:CCGGATGGACTTGAACCCGTCCTTCCTCGAGGAAGGACGGGTTCAAGTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203453.2-1012s21c1
Sequence:CCGGATTCGATGATGTCAACCTAAACTCGAGTTTAGGTTGACATCATCGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000244971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-890s21c1
Sequence:CCGGAGTACAGCATCGTGGACTATTCTCGAGAATAGTCCACGATGCTGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000244970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_203453.2-846s21c1
Sequence:CCGGCAATGTCACCGACGTAGCTTTCTCGAGAAAGCTACGTCGGTGACATTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203453.2-688s21c1
Sequence:CCGGTCGGTGGACAAGTACTCCTTCCTCGAGGAAGGAGTACTTGTCCACCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028922
PPAPDC2 MISSION shRNA Bacterial Glycerol Stock
phosphatidic acid phosphatase type 2 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-918s1c1
Sequence:CCGGCCCACAATGTTCCAGTTCTTTCTCGAGAAAGAACTGGAACATTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-884s1c1
Sequence:CCGGCAGTACAGCATTGTGGATTATCTCGAGATAATCCACAATGCTGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028922.1-1131s1c1
Sequence:CCGGCGGCCATACTTGAGAAACAAACTCGAGTTTGTTTCTCAAGTATGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-892s1c1
Sequence:CCGGCATTGTGGATTATTGCTGGCTCTCGAGAGCCAGCAATAATCCACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-739s1c2
Sequence:CCGGGCGGTTTATCCTAAACCACCTCTCGAGAGGTGGTTTAGGATAAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028922
PPAPDC2 MISSION shRNA shRNA Plasmid DNA
phosphatidic acid phosphatase type 2 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-918s1c1
Sequence:CCGGCCCACAATGTTCCAGTTCTTTCTCGAGAAAGAACTGGAACATTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-884s1c1
Sequence:CCGGCAGTACAGCATTGTGGATTATCTCGAGATAATCCACAATGCTGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028922.1-1131s1c1
Sequence:CCGGCGGCCATACTTGAGAAACAAACTCGAGTTTGTTTCTCAAGTATGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-892s1c1
Sequence:CCGGCATTGTGGATTATTGCTGGCTCTCGAGAGCCAGCAATAATCCACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-739s1c2
Sequence:CCGGGCGGTTTATCCTAAACCACCTCTCGAGAGGTGGTTTAGGATAAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028922
PPAPDC2 MISSION shRNA Lentiviral Transduction Particles
phosphatidic acid phosphatase type 2 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-918s1c1
Sequence:CCGGCCCACAATGTTCCAGTTCTTTCTCGAGAAAGAACTGGAACATTGTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-884s1c1
Sequence:CCGGCAGTACAGCATTGTGGATTATCTCGAGATAATCCACAATGCTGTACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028922.1-1131s1c1
Sequence:CCGGCGGCCATACTTGAGAAACAAACTCGAGTTTGTTTCTCAAGTATGGCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-892s1c1
Sequence:CCGGCATTGTGGATTATTGCTGGCTCTCGAGAGCCAGCAATAATCCACAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028922.1-739s1c2
Sequence:CCGGGCGGTTTATCCTAAACCACCTCTCGAGAGGTGGTTTAGGATAAACCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???