EMAIL THIS PAGE TO A FRIEND

PPARA

peroxisome proliferator-activated receptor alpha

185 Gene Product Result for
Synonyms: NR1C1 PPAR PPARalpha hPPAR
Gene ID:
Human(5465) Summary: Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
Mouse(19013) peroxisome proliferator activated receptor alpha
Rat(25747) peroxisome proliferator activated receptor alpha
Domestic Rabbit(100009308) peroxisome proliferator-activated receptor alpha
naked mole-rat(101725514) peroxisome proliferator-activated receptor alpha
domestic guinea pig(100135604) peroxisome proliferator activated receptor alpha
cow(281992) peroxisome proliferator-activated receptor alpha
sheep(100190976) peroxisome proliferator-activated receptor alpha
Goat(100861393) peroxisome proliferator-activated receptor alpha
chicken(374120) peroxisome proliferator-activated receptor alpha
dog(403654) peroxisome proliferator-activated receptor alpha
domestic cat(101095837) peroxisome proliferator-activated receptor alpha
Horse(100049840) peroxisome proliferator-activated receptor alpha
domestic cat(100049013) peroxisome proliferator-activated receptor alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P0369 Anti-Peroxisome Proliferator Activated Receptor α antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
P249 Anti-Peroxisome Proliferator Activated Receptor antibody produced in rabbit whole antiserum, buffered aqueous solution rat, mouse
immunoprecipitation (IP), western blot pricing
P8496 Anti-phospho-Peroxisome Proliferator Activated Receptor α (pSer12) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
P8621 Anti-phospho-Peroxisome Proliferator Activated Receptor α (pSer21) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB4502260 Anti-PPAR-α antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB1406277 Anti-PPARA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA067049 Anti-PPARA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
HPA058901 Anti-PPARA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2101852 Anti-PPARA antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
AV34113 Anti-PPARA antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2104354 Anti-PPARA, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, goat, horse, guinea pig, human, rabbit
western blot pricing
P0869 Monoclonal Anti-Peroxisome Proliferator Activated Receptor α antibody produced in mouse ~1 mg/mL, clone 3B6/PPAR, purified immunoglobulin, buffered aqueous solution rat, mouse, human
western blot pricing
SAB4100408 Monoclonal Anti-PPARA antibody produced in mouse clone PPARA-A349, culture supernatant human
western blot pricing
SAB1402875 Monoclonal Anti-PPARA antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

Small Molecule - Activator

Product # Description Species Add to Cart
 
197777 2-(p-Chlorophenoxy)-2-methylpropionic acid 97% human, mouse pricing
B7273 Bezafibrate ≥98%, solid human, mouse pricing
C7081 WY-14643 human, mouse, rat pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
796565 2-[4-(4-Chlorobenzoyl)phenoxy]-2-methylpropionic acid 95% human pricing
72516 Bezafibrate analytical standard human pricing
B1115000 Bezafibrate European Pharmacopoeia (EP) Reference Standard human pricing
BP755 Bezafibrate British Pharmacopoeia (BP) Reference Standard human pricing
C0330 Ciprofibrate human pricing
Y0000362 Ciprofibrate European Pharmacopoeia (EP) Reference Standard human pricing
Y0000363 Ciprofibrate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1139000 Clofibrate United States Pharmacopeia (USP) Reference Standard human pricing
C2300000 Clofibrate European Pharmacopoeia (EP) Reference Standard human pricing
41326 Clofibrate analytical standard human pricing
F6020 Fenofibrate ≥99%, powder human pricing
PHR1246 Fenofibrate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1269447 Fenofibrate United States Pharmacopeia (USP) Reference Standard human pricing
F0048000 Fenofibrate European Pharmacopoeia (EP) Reference Standard human pricing
55443 Fenofibrate analytical standard human pricing
F0048010 Fenofibrate impurity B European Pharmacopoeia (EP) Reference Standard human pricing
1269618 Fenofibrate Related Compound B United States Pharmacopeia (USP) Reference Standard human pricing
90568 Fenofibric acid analytical standard human pricing
G9518 Gemfibrozil human pricing
PHR1286 Gemfibrozil Pharmaceutical Secondary Standard; Certified Reference Material human pricing
91823 Gemfibrozil analytical standard human pricing
BP363 Gemfibrozil British Pharmacopoeia (BP) Reference Standard human pricing
1288500 Gemfibrozil United States Pharmacopeia (USP) Reference Standard human pricing
Y0000513 Gemfibrozil European Pharmacopoeia (EP) Reference Standard human pricing
Y0000514 Gemfibrozil for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
G6793 GW7647 ≥98% (HPLC) human pricing
SML1369 Tesaglitazar ≥98% (HPLC) human pricing
T1698 Tetradecylthioacetic acid ≥97% (NMR) human pricing
C6643 Clofibrate liquid human, mouse pricing
O0383 N-Oleoylethanolamine ~98% (TLC) human, mouse, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G3295 GW0742 ≥98% (HPLC) human pricing
T2573 Troglitazone ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151821 MISSION® esiRNA targeting human PPARA human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001928 Rosetta Predictions human pricing
NM_001001929 Rosetta Predictions human pricing
NM_001001930 Rosetta Predictions human pricing
NM_005036 Rosetta Predictions human pricing
NM_032644 Rosetta Predictions human pricing
NM_013196 Rosetta Predictions rat pricing
NM_001113418 Rosetta Predictions mouse pricing
NM_011144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304005 predicted 873
2 SASI_Hs02_00304006 predicted 1185
3 SASI_Hs02_00304007 predicted 1084
4 SASI_Hs02_00304008 predicted 1575
5 SASI_Hs02_00304009 predicted 1346
6 SASI_Hs02_00304010 predicted 674
7 SASI_Hs02_00304011 predicted 1682
8 SASI_Hs02_00304012 predicted 649
9 SASI_Hs01_00139350 predicted 640
10 SASI_Hs02_00304013 predicted 810
11 SASI_Hs01_00139343 predicted 643
12 SASI_Hs01_00139344 predicted 469
13 SASI_Hs01_00139345 predicted 572
14 SASI_Hs01_00139346 predicted 475
15 SASI_Hs01_00139347 predicted 378
16 SASI_Hs01_00139348 predicted 662
17 SASI_Hs01_00139349 predicted 641
18 SASI_Hs01_00139351 predicted 496
19 SASI_Hs01_00139352 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179410 predicted 712
2 SASI_Hs01_00179411 predicted 542
3 SASI_Hs01_00179412 predicted 642
4 SASI_Hs01_00179413 predicted 543
5 SASI_Hs01_00179414 predicted 443
6 SASI_Hs01_00179415 predicted 729
7 SASI_Hs01_00179416 predicted 710
8 SASI_Hs01_00179417 predicted 710
9 SASI_Hs01_00179418 predicted 569
10 SASI_Hs01_00179419 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050994 predicted 997
2 SASI_Hs01_00050995 predicted 828
3 SASI_Hs01_00050996 predicted 932
4 SASI_Hs01_00050997 predicted 829
5 SASI_Hs01_00050998 predicted 736
6 SASI_Hs01_00050999 predicted 1020
7 SASI_Hs01_00051000 predicted 994
8 SASI_Hs01_00051001 predicted 1001
9 SASI_Hs01_00051002 predicted 861
10 SASI_Hs01_00051003 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338826 predicted 960
2 SASI_Hs02_00338827 predicted 1272
3 SASI_Hs02_00338828 predicted 1170
4 SASI_Hs02_00338829 predicted 1660
5 SASI_Hs02_00338830 predicted 1431
6 SASI_Hs02_00338831 predicted 762
7 SASI_Hs02_00338832 predicted 1761
8 SASI_Hs02_00338833 predicted 727
9 SASI_Hs01_00082037 predicted 721
10 SASI_Hs02_00338834 predicted 898
11 SASI_Hs01_00082030 predicted 721
12 SASI_Hs01_00082031 predicted 558
13 SASI_Hs01_00082032 predicted 662
14 SASI_Hs01_00082033 predicted 553
15 SASI_Hs01_00082034 predicted 458
16 SASI_Hs01_00082035 predicted 751
17 SASI_Hs01_00082036 predicted 722
18 SASI_Hs01_00082038 predicted 584
19 SASI_Hs01_00082039 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040379 predicted 673
2 SASI_Hs01_00040380 predicted 501
3 SASI_Hs01_00040381 predicted 609
4 SASI_Hs01_00040382 predicted 503
5 SASI_Hs01_00040383 predicted 410
6 SASI_Hs01_00040384 predicted 688
7 SASI_Hs01_00040385 predicted 667
8 SASI_Hs01_00040386 predicted 665
9 SASI_Hs01_00040387 predicted 524
10 SASI_Hs01_00040388 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080832 predicted 445
2 SASI_Rn01_00080833 predicted 759
3 SASI_Rn01_00080834 predicted 953
4 SASI_Rn01_00080835 predicted 1538
5 SASI_Rn01_00080836 predicted 665
6 SASI_Rn01_00080837 predicted 466
7 SASI_Rn01_00080838 predicted 832
8 SASI_Rn02_00261067 predicted 765
9 SASI_Rn01_00080840 predicted 1308
10 SASI_Rn01_00080841 predicted 1298
11 SASI_Rn01_00080839 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307846 predicted 763
2 SASI_Mm02_00307847 predicted 489
3 SASI_Mm02_00307848 predicted 1375
4 SASI_Mm02_00307849 predicted 1129
5 SASI_Mm02_00307850 predicted 1212
6 SASI_Mm02_00307851 predicted 1388
7 SASI_Mm02_00307852 predicted 785
8 SASI_Mm02_00307853 predicted 1305
9 SASI_Mm02_00307854 predicted 653
10 SASI_Mm02_00307855 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319988 predicted 993
2 SASI_Mm01_00072543 predicted 736
3 SASI_Mm01_00072544 predicted 1615
4 SASI_Mm01_00072545 predicted 1367
5 SASI_Mm01_00072546 predicted 1452
6 SASI_Mm02_00319989 predicted 1624
7 SASI_Mm01_00072547 predicted 1028
8 SASI_Mm01_00072548 predicted 1536
9 SASI_Mm01_00072549 predicted 892
10 SASI_Mm01_00072550 predicted 986
11 SASI_Mm01_00072551 predicted 520
12 SASI_Mm01_00072552 predicted 544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005036
VALIDATED
PPARA MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005036.x-599s1c1
Sequence:CCGGGATTCGACTCAAGCTGGTGTACTCGAGTACACCAGCTTGAGTCGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-656s1c1
Sequence:CCGGGAACAGAAACAAATGCCAGTACTCGAGTACTGGCATTTGTTTCTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-495s1c1
Sequence:CCGGAGTGGAGCATTGAACATCGAACTCGAGTTCGATGTTCAATGCTCCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005036.x-1708s1c1
Sequence:CCGGATATCCACCACTTTAACCTTACTCGAGTAAGGTTAAAGTGGTGGATATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-1206s1c1
Sequence:CCGGGTAGCGTATGGAAATGGGTTTCTCGAGAAACCCATTTCCATACGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-316s21c1
Sequence:CCGGGCGATCTAGAGAGCCCGTTATCTCGAGATAACGGGCTCTCTAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1263s21c1
Sequence:CCGGGCGTATGGAAATGGGTTTATACTCGAGTATAAACCCATTTCCATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-415s21c1
Sequence:CCGGGCTTTACGGAATACCAGTATTCTCGAGAATACTGGTATTCCGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1802s21c1
Sequence:CCGGTGTAGGTAACCGGCATATTATCTCGAGATAATATGCCGGTTACCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1200s21c1
Sequence:CCGGGGAGTTTATGAGGCCATATTCCTCGAGGAATATGGCCTCATAAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005036
VALIDATED
PPARA MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005036.x-599s1c1
Sequence:CCGGGATTCGACTCAAGCTGGTGTACTCGAGTACACCAGCTTGAGTCGAATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-656s1c1
Sequence:CCGGGAACAGAAACAAATGCCAGTACTCGAGTACTGGCATTTGTTTCTGTTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-495s1c1
Sequence:CCGGAGTGGAGCATTGAACATCGAACTCGAGTTCGATGTTCAATGCTCCACTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005036.x-1708s1c1
Sequence:CCGGATATCCACCACTTTAACCTTACTCGAGTAAGGTTAAAGTGGTGGATATTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-1206s1c1
Sequence:CCGGGTAGCGTATGGAAATGGGTTTCTCGAGAAACCCATTTCCATACGCTACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-316s21c1
Sequence:CCGGGCGATCTAGAGAGCCCGTTATCTCGAGATAACGGGCTCTCTAGATCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1263s21c1
Sequence:CCGGGCGTATGGAAATGGGTTTATACTCGAGTATAAACCCATTTCCATACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-415s21c1
Sequence:CCGGGCTTTACGGAATACCAGTATTCTCGAGAATACTGGTATTCCGTAAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1802s21c1
Sequence:CCGGTGTAGGTAACCGGCATATTATCTCGAGATAATATGCCGGTTACCTACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000257342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1200s21c1
Sequence:CCGGGGAGTTTATGAGGCCATATTCCTCGAGGAATATGGCCTCATAAACTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005036
VALIDATED
PPARA MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005036.x-599s1c1
Sequence:CCGGGATTCGACTCAAGCTGGTGTACTCGAGTACACCAGCTTGAGTCGAATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-656s1c1
Sequence:CCGGGAACAGAAACAAATGCCAGTACTCGAGTACTGGCATTTGTTTCTGTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-495s1c1
Sequence:CCGGAGTGGAGCATTGAACATCGAACTCGAGTTCGATGTTCAATGCTCCACTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005036.x-1708s1c1
Sequence:CCGGATATCCACCACTTTAACCTTACTCGAGTAAGGTTAAAGTGGTGGATATTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005036.x-1206s1c1
Sequence:CCGGGTAGCGTATGGAAATGGGTTTCTCGAGAAACCCATTTCCATACGCTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-316s21c1
Sequence:CCGGGCGATCTAGAGAGCCCGTTATCTCGAGATAACGGGCTCTCTAGATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1263s21c1
Sequence:CCGGGCGTATGGAAATGGGTTTATACTCGAGTATAAACCCATTTCCATACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-415s21c1
Sequence:CCGGGCTTTACGGAATACCAGTATTCTCGAGAATACTGGTATTCCGTAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1802s21c1
Sequence:CCGGTGTAGGTAACCGGCATATTATCTCGAGATAATATGCCGGTTACCTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005036.4-1200s21c1
Sequence:CCGGGGAGTTTATGAGGCCATATTCCTCGAGGAATATGGCCTCATAAACTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011144
PPARA MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor alpha
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1530s1c1
Sequence:CCGGGCTATGAAGTTCAATGCCTTACTCGAGTAAGGCATTGAACTTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011144.2-2727s1c1
Sequence:CCGGGCTCCTTTGATATGATACTTTCTCGAGAAAGTATCATATCAAAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1002s1c1
Sequence:CCGGGCAGAAATTCTTACCTGTGAACTCGAGTTCACAGGTAAGAATTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1616s1c1
Sequence:CCGGCCTTCTAAACATAGGCTACATCTCGAGATGTAGCCTATGTTTAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-510s1c1
Sequence:CCGGCCCTTATCTGAAGAATTCTTACTCGAGTAAGAATTCTTCAGATAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011144.6-2026s21c1
Sequence:CCGGAGACTACCTGCTACCGAAATGCTCGAGCATTTCGGTAGCAGGTAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011144.6-738s21c1
Sequence:CCGGTGAACATCGAGTGTCGAATATCTCGAGATATTCGACACTCGATGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011144.6-2138s21c1
Sequence:CCGGGCACTCTACGTTGCGTTTATACTCGAGTATAAACGCAACGTAGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011144
PPARA MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor alpha
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1530s1c1
Sequence:CCGGGCTATGAAGTTCAATGCCTTACTCGAGTAAGGCATTGAACTTCATAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011144.2-2727s1c1
Sequence:CCGGGCTCCTTTGATATGATACTTTCTCGAGAAAGTATCATATCAAAGGAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1002s1c1
Sequence:CCGGGCAGAAATTCTTACCTGTGAACTCGAGTTCACAGGTAAGAATTTCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1616s1c1
Sequence:CCGGCCTTCTAAACATAGGCTACATCTCGAGATGTAGCCTATGTTTAGAAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-510s1c1
Sequence:CCGGCCCTTATCTGAAGAATTCTTACTCGAGTAAGAATTCTTCAGATAAGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000438283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011144.6-2026s21c1
Sequence:CCGGAGACTACCTGCTACCGAAATGCTCGAGCATTTCGGTAGCAGGTAGTCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000413243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011144.6-738s21c1
Sequence:CCGGTGAACATCGAGTGTCGAATATCTCGAGATATTCGACACTCGATGTTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000416114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011144.6-2138s21c1
Sequence:CCGGGCACTCTACGTTGCGTTTATACTCGAGTATAAACGCAACGTAGAGTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011144
PPARA MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor alpha
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1530s1c1
Sequence:CCGGGCTATGAAGTTCAATGCCTTACTCGAGTAAGGCATTGAACTTCATAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011144.2-2727s1c1
Sequence:CCGGGCTCCTTTGATATGATACTTTCTCGAGAAAGTATCATATCAAAGGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1002s1c1
Sequence:CCGGGCAGAAATTCTTACCTGTGAACTCGAGTTCACAGGTAAGAATTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-1616s1c1
Sequence:CCGGCCTTCTAAACATAGGCTACATCTCGAGATGTAGCCTATGTTTAGAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011144.2-510s1c1
Sequence:CCGGCCCTTATCTGAAGAATTCTTACTCGAGTAAGAATTCTTCAGATAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011144.6-2026s21c1
Sequence:CCGGAGACTACCTGCTACCGAAATGCTCGAGCATTTCGGTAGCAGGTAGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011144.6-738s21c1
Sequence:CCGGTGAACATCGAGTGTCGAATATCTCGAGATATTCGACACTCGATGTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011144.6-2138s21c1
Sequence:CCGGGCACTCTACGTTGCGTTTATACTCGAGTATAAACGCAACGTAGAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)