EMAIL THIS PAGE TO A FRIEND

PPARD

peroxisome proliferator-activated receptor delta

69 Gene Product Result for
Synonyms: FAAR NR1C2 NUC1 NUCI NUCII PPARB
Gene ID:
Human(5467) Summary: This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. PPARs are nuclear hormone receptors that bind peroxisome proliferators and control the size and number of peroxisomes produced by cells. PPARs mediate a variety of biological processes, and may be involved in the development of several chronic diseases, including diabetes, obesity, atherosclerosis, and cancer. This protein is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma. It may function as an integrator of transcription repression and nuclear receptor signaling. The expression of this gene is found to be elevated in colorectal cancer cells. The elevated expression can be repressed by adenomatosis polyposis coli (APC), a tumor suppressor protein related to APC/beta-catenin signaling pathway. Knockout studies in mice suggested the role of this protein in myelination of the corpus callosum, lipid metabolism, and epidermal cell proliferation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Mouse(19015) peroxisome proliferator activator receptor delta
Rat(25682) peroxisome proliferator-activated receptor delta
chicken(395479) peroxisome proliferator-activated receptor delta
dog(481756) peroxisome proliferator-activated receptor delta
Horse(100053404) peroxisome proliferator-activated receptor delta
domestic cat(101098383) peroxisome proliferator-activated receptor delta
cow(353106) peroxisome proliferator-activated receptor delta
sheep(101117625) peroxisome proliferator-activated receptor delta
domestic guinea pig(100725136) peroxisome proliferator-activated receptor delta
naked mole-rat(101722175) peroxisome proliferator-activated receptor delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Activator

Product # Description Species Add to Cart
 
C3305 Carbacyclin ≥90% (HPLC) human pricing
B7273 Bezafibrate ≥98%, solid human, mouse pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G3295 GW0742 ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006238 Rosetta Predictions human pricing
NM_013141 Rosetta Predictions rat pricing
NM_011145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236946 predicted 986
2 SASI_Hs01_00236947 predicted 934
3 SASI_Hs02_00341155 predicted 1350
4 SASI_Hs01_00236948 predicted 1364
5 SASI_Hs01_00236950 predicted 1270
6 SASI_Hs01_00236951 predicted 615
7 SASI_Hs01_00236952 predicted 714
8 SASI_Hs01_00236953 predicted 1436
9 SASI_Hs01_00236954 predicted 1132
10 SASI_Hs01_00236955 predicted 1335
11 SASI_Hs01_00236949 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073585 predicted 483
2 SASI_Rn02_00260938 predicted 1239
3 SASI_Rn01_00073586 predicted 1307
4 SASI_Rn01_00073587 predicted 1217
5 SASI_Rn01_00073588 predicted 609
6 SASI_Rn01_00073590 predicted 1337
7 SASI_Rn01_00073591 predicted 669
8 SASI_Rn01_00073594 predicted 1187
9 SASI_Rn02_00260939 predicted 1248
10 SASI_Rn02_00260940 predicted 1376
11 SASI_Rn01_00073589 predicted 1375
12 SASI_Rn01_00073592 predicted 877
13 SASI_Rn01_00073593 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042004 predicted 1324
2 SASI_Mm01_00042005 predicted 1252
3 SASI_Mm01_00042006 predicted 859
4 SASI_Mm02_00319990 predicted 603
5 SASI_Mm01_00042007 predicted 2009
6 SASI_Mm01_00042008 predicted 629
7 SASI_Mm01_00042009 predicted 1014
8 SASI_Mm01_00042010 predicted 887
9 SASI_Mm01_00042011 predicted 687
10 SASI_Mm01_00042012 predicted 570
11 SASI_Mm01_00042003 predicted 1398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006238
VALIDATED
PPARD MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor delta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-988s21c1
Sequence:CCGGGTGTGGAAGCAGTTGGTGAATCTCGAGATTCACCAACTGCTTCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-1269s21c1
Sequence:CCGGCCGCAAACCCTTCAGTGATATCTCGAGATATCACTGAAGGGTTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1314s1c1
Sequence:CCGGCCGCAAACCCTTCAGTGATATCTCGAGATATCACTGAAGGGTTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1401s1c1
Sequence:CCGGCCTATTCATTGCGGCCATCATCTCGAGATGATGGCCGCAATGAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-946s21c1
Sequence:CCGGATCCACGACATCGAGACATTGCTCGAGCAATGTCTCGATGTCGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1033s1c1
Sequence:CCGGGTGTGGAAGCAGTTGGTGAATCTCGAGATTCACCAACTGCTTCCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1932s1c1
Sequence:CCGGGTATTATTTCACCAGCAGCATCTCGAGATGCTGCTGGTGAAATAATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006238.3-1994s21c1
Sequence:CCGGGTATTATTTCACCAGCAGCATCTCGAGATGCTGCTGGTGAAATAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-1358s21c1
Sequence:CCGGTATTCATTGCGGCCATCATTCCTCGAGGAATGATGGCCGCAATGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1611s1c1
Sequence:CCGGGATCAAGAAGACCGAAACCGACTCGAGTCGGTTTCGGTCTTCTTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006238
VALIDATED
PPARD MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor delta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-988s21c1
Sequence:CCGGGTGTGGAAGCAGTTGGTGAATCTCGAGATTCACCAACTGCTTCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-1269s21c1
Sequence:CCGGCCGCAAACCCTTCAGTGATATCTCGAGATATCACTGAAGGGTTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1314s1c1
Sequence:CCGGCCGCAAACCCTTCAGTGATATCTCGAGATATCACTGAAGGGTTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1401s1c1
Sequence:CCGGCCTATTCATTGCGGCCATCATCTCGAGATGATGGCCGCAATGAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-946s21c1
Sequence:CCGGATCCACGACATCGAGACATTGCTCGAGCAATGTCTCGATGTCGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1033s1c1
Sequence:CCGGGTGTGGAAGCAGTTGGTGAATCTCGAGATTCACCAACTGCTTCCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1932s1c1
Sequence:CCGGGTATTATTTCACCAGCAGCATCTCGAGATGCTGCTGGTGAAATAATACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006238.3-1994s21c1
Sequence:CCGGGTATTATTTCACCAGCAGCATCTCGAGATGCTGCTGGTGAAATAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-1358s21c1
Sequence:CCGGTATTCATTGCGGCCATCATTCCTCGAGGAATGATGGCCGCAATGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1611s1c1
Sequence:CCGGGATCAAGAAGACCGAAACCGACTCGAGTCGGTTTCGGTCTTCTTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006238
VALIDATED
PPARD MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor delta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-988s21c1
Sequence:CCGGGTGTGGAAGCAGTTGGTGAATCTCGAGATTCACCAACTGCTTCCACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-1269s21c1
Sequence:CCGGCCGCAAACCCTTCAGTGATATCTCGAGATATCACTGAAGGGTTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1314s1c1
Sequence:CCGGCCGCAAACCCTTCAGTGATATCTCGAGATATCACTGAAGGGTTTGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1401s1c1
Sequence:CCGGCCTATTCATTGCGGCCATCATCTCGAGATGATGGCCGCAATGAATAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-946s21c1
Sequence:CCGGATCCACGACATCGAGACATTGCTCGAGCAATGTCTCGATGTCGTGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1033s1c1
Sequence:CCGGGTGTGGAAGCAGTTGGTGAATCTCGAGATTCACCAACTGCTTCCACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1932s1c1
Sequence:CCGGGTATTATTTCACCAGCAGCATCTCGAGATGCTGCTGGTGAAATAATACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006238.3-1994s21c1
Sequence:CCGGGTATTATTTCACCAGCAGCATCTCGAGATGCTGCTGGTGAAATAATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006238.3-1358s21c1
Sequence:CCGGTATTCATTGCGGCCATCATTCCTCGAGGAATGATGGCCGCAATGAATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006238.x-1611s1c1
Sequence:CCGGGATCAAGAAGACCGAAACCGACTCGAGTCGGTTTCGGTCTTCTTGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011145
PPARD MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor delta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-1294s1c1
Sequence:CCGGGCCCAGATGATGCAGTGGCTACTCGAGTAGCCACTGCATCATCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-1311s1c1
Sequence:CCGGGCTAAAGAAGACGGAGAGTGACTCGAGTCACTCTCCGTCTTCTTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-579s1c1
Sequence:CCGGGAAGGCCTTCTCTAAGCACATCTCGAGATGTGCTTAGAGAAGGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-414s1c1
Sequence:CCGGGAACCGCAACAAGTGTCAGTACTCGAGTACTGACACTTGTTGCGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026001    
Product Details

Region:
TRC Version: 1 Clone ID:NM_011145.1-370s1c1
Sequence:CCGGCTCGAGTATGAGAAGTGCGATCTCGAGATCGCACTTCTCATACTCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011145
PPARD MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor delta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-1294s1c1
Sequence:CCGGGCCCAGATGATGCAGTGGCTACTCGAGTAGCCACTGCATCATCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-1311s1c1
Sequence:CCGGGCTAAAGAAGACGGAGAGTGACTCGAGTCACTCTCCGTCTTCTTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-579s1c1
Sequence:CCGGGAAGGCCTTCTCTAAGCACATCTCGAGATGTGCTTAGAGAAGGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-414s1c1
Sequence:CCGGGAACCGCAACAAGTGTCAGTACTCGAGTACTGACACTTGTTGCGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026001    
Product Details

Region:
TRC Version: 1 Clone ID:NM_011145.1-370s1c1
Sequence:CCGGCTCGAGTATGAGAAGTGCGATCTCGAGATCGCACTTCTCATACTCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011145
PPARD MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor delta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-1294s1c1
Sequence:CCGGGCCCAGATGATGCAGTGGCTACTCGAGTAGCCACTGCATCATCTGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-1311s1c1
Sequence:CCGGGCTAAAGAAGACGGAGAGTGACTCGAGTCACTCTCCGTCTTCTTTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-579s1c1
Sequence:CCGGGAAGGCCTTCTCTAAGCACATCTCGAGATGTGCTTAGAGAAGGCCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011145.1-414s1c1
Sequence:CCGGGAACCGCAACAAGTGTCAGTACTCGAGTACTGACACTTGTTGCGGTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026001    
Product Details

Region:
TRC Version: 1 Clone ID:NM_011145.1-370s1c1
Sequence:CCGGCTCGAGTATGAGAAGTGCGATCTCGAGATCGCACTTCTCATACTCGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)