EMAIL THIS PAGE TO A FRIEND

PPARG

peroxisome proliferator-activated receptor gamma

166 Gene Product Result for
Synonyms: CIMT1 GLM1 NR1C3 PPARG1 PPARG2 PPARgamma
Gene ID:
Human(5468) Summary: This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(19016) peroxisome proliferator activated receptor gamma
Rat(25664) peroxisome proliferator-activated receptor gamma
Zebrafish(557037) peroxisome proliferator activated receptor gamma
chicken(373928) peroxisome proliferator-activated receptor gamma
dog(403606) peroxisome proliferator-activated receptor gamma
domestic cat(100049014) peroxisome proliferator-activated receptor gamma
domestic cat(101095161) peroxisome proliferator-activated receptor gamma
naked mole-rat(101711078) peroxisome proliferator-activated receptor gamma
domestic guinea pig(100729138) peroxisome proliferator-activated receptor gamma
cow(281993) peroxisome proliferator-activated receptor gamma
Goat(100861309) peroxisome proliferator-activated receptor gamma
sheep(443513) peroxisome proliferator-activated receptor gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P0744 Anti-Peroxisome Proliferator Activated Receptor γ 2 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse
immunofluorescence, western blot pricing
SAB4503977 Anti-phospho-PPAR-γ (pSer112) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4502262 Anti-PPAR-γ antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
AV32880 Anti-PPARG (AB1) antibody produced in rabbit IgG fraction of antiserum rabbit, guinea pig, human, dog, rat, mouse, horse
immunohistochemistry, western blot pricing
AV39207 Anti-PPARG (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder pig, human, canine
western blot pricing
GW21258 Anti-PPARγ antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB2107966 Anti-PPARG antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA051239 Anti-PPARG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA063663 Anti-PPARG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunofluorescence, western blot pricing
SAB2103362 Anti-PPARG, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB5300032 Monoclonal Anti-PPARG antibody produced in mouse clone 3A4A9, ascites fluid human
ELISA, western blot pricing

Small Molecule - Activator

Product # Description Species Add to Cart
 
C3305 Carbacyclin ≥90% (HPLC) human pricing
197777 2-(p-Chlorophenoxy)-2-methylpropionic acid 97% human, mouse pricing
B7273 Bezafibrate ≥98%, solid human, mouse pricing
C7081 WY-14643 human, mouse, rat pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
G5668 GW1929 hydrate >98% (HPLC), solid human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
14010 O-Benzyl-L-tyrosine ≥99.0% (NT) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005037 Rosetta Predictions human pricing
NM_015869 Rosetta Predictions human pricing
NM_138711 Rosetta Predictions human pricing
NM_138712 Rosetta Predictions human pricing
NM_013124 Rosetta Predictions rat pricing
NM_001127330 Rosetta Predictions mouse pricing
NM_011146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106498 predicted 1269
2 SASI_Hs01_00106499 predicted 585
3 SASI_Hs01_00106500 predicted 690
4 SASI_Hs01_00106501 predicted 1283
5 SASI_Hs01_00106502 predicted 919
6 SASI_Hs01_00106503 predicted 1491
7 SASI_Hs01_00106504 predicted 456
8 SASI_Hs01_00106505 predicted 1050
9 SASI_Hs01_00106506 predicted 599
10 SASI_Hs01_00106507 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015248 predicted 1266
2 SASI_Hs01_00015249 predicted 586
3 SASI_Hs01_00015250 predicted 692
4 SASI_Hs01_00015251 predicted 1280
5 SASI_Hs01_00015252 predicted 917
6 SASI_Hs01_00015253 predicted 1498
7 SASI_Hs01_00015254 predicted 461
8 SASI_Hs01_00015255 predicted 1048
9 SASI_Hs01_00015256 predicted 604
10 SASI_Hs01_00015257 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110380 predicted 1369
2 SASI_Hs01_00110381 predicted 677
3 SASI_Hs01_00110382 predicted 797
4 SASI_Hs01_00110383 predicted 1383
5 SASI_Hs01_00110384 predicted 1018
6 SASI_Hs01_00110385 predicted 1595
7 SASI_Hs01_00110386 predicted 565
8 SASI_Hs01_00110387 predicted 1155
9 SASI_Hs01_00110388 predicted 700
10 SASI_Hs01_00110389 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218389 predicted 1341
2 SASI_Hs01_00218390 predicted 657
3 SASI_Hs01_00218391 predicted 770
4 SASI_Hs01_00218392 predicted 1356
5 SASI_Hs01_00218393 predicted 989
6 SASI_Hs01_00218394 predicted 1570
7 SASI_Hs01_00218395 predicted 539
8 SASI_Hs01_00218396 predicted 1129
9 SASI_Hs01_00218397 predicted 671
10 SASI_Hs01_00218398 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077685 predicted 610
2 SASI_Rn01_00077686 predicted 810
3 SASI_Rn01_00077687 predicted 375
4 SASI_Rn01_00077689 predicted 1187
5 SASI_Rn02_00260905 predicted 227
6 SASI_Rn01_00077690 predicted 200
7 SASI_Rn01_00077691 predicted 965
8 SASI_Rn01_00077692 predicted 803
9 SASI_Rn01_00077693 predicted 1227
10 SASI_Rn01_00077694 predicted 205
11 SASI_Rn01_00077688 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310237 predicted 937
2 SASI_Mm02_00310238 predicted 1319
3 SASI_Mm02_00310239 predicted 1313
4 SASI_Mm02_00310240 predicted 1091
5 SASI_Mm02_00310241 predicted 743
6 SASI_Mm02_00310242 predicted 945
7 SASI_Mm02_00310243 predicted 1246
8 SASI_Mm02_00310244 predicted 1477
9 SASI_Mm02_00310245 predicted 1369
10 SASI_Mm02_00310246 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172956 predicted 846
2 SASI_Mm01_00172957 predicted 1239
3 SASI_Mm01_00172958 predicted 1225
4 SASI_Mm01_00172960 predicted 1002
5 SASI_Mm01_00172963 predicted 655
6 SASI_Mm01_00172964 predicted 855
7 SASI_Mm02_00319991 predicted 1163
8 SASI_Mm02_00319992 predicted 1386
9 SASI_Mm02_00319993 predicted 1280
10 SASI_Mm02_00319994 predicted 1237
11 SASI_Mm01_00172959 predicted 227
12 SASI_Mm01_00172961 predicted 214
13 SASI_Mm01_00172962 predicted 235
14 SASI_Mm01_00172965 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138712
VALIDATED
PPARG MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-1160s1c1
Sequence:CCGGCTGGCCTCCTTGATGAATAAACTCGAGTTTATTCATCAAGGAGGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-1055s1c1
Sequence:CCGGGAGATCACAGAGTATGCCAAACTCGAGTTTGGCATACTCTGTGATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-301s1c1
Sequence:CCGGCAGCATTTCTACTCCACATTACTCGAGTAATGTGGAGTAGAAATGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-892s1c1
Sequence:CCGGGACAACAGACAAATCACCATTCTCGAGAATGGTGATTTGTCTGTTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-1206s21c1
Sequence:CCGGATGGAGTCCACGAGATCATTTCTCGAGAAATGATCTCGTGGACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-1388s21c1
Sequence:CCGGGACAGCGACTTGGCAATATTTCTCGAGAAATATTGCCAAGTCGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-302s21c1
Sequence:CCGGTCCGTGGATCTCTCCGTAATGCTCGAGCATTACGGAGAGATCCACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138712
VALIDATED
PPARG MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-1160s1c1
Sequence:CCGGCTGGCCTCCTTGATGAATAAACTCGAGTTTATTCATCAAGGAGGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-1055s1c1
Sequence:CCGGGAGATCACAGAGTATGCCAAACTCGAGTTTGGCATACTCTGTGATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-301s1c1
Sequence:CCGGCAGCATTTCTACTCCACATTACTCGAGTAATGTGGAGTAGAAATGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-892s1c1
Sequence:CCGGGACAACAGACAAATCACCATTCTCGAGAATGGTGATTTGTCTGTTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-1206s21c1
Sequence:CCGGATGGAGTCCACGAGATCATTTCTCGAGAAATGATCTCGTGGACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-1388s21c1
Sequence:CCGGGACAGCGACTTGGCAATATTTCTCGAGAAATATTGCCAAGTCGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-302s21c1
Sequence:CCGGTCCGTGGATCTCTCCGTAATGCTCGAGCATTACGGAGAGATCCACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138712
VALIDATED
PPARG MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-1160s1c1
Sequence:CCGGCTGGCCTCCTTGATGAATAAACTCGAGTTTATTCATCAAGGAGGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-1055s1c1
Sequence:CCGGGAGATCACAGAGTATGCCAAACTCGAGTTTGGCATACTCTGTGATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-301s1c1
Sequence:CCGGCAGCATTTCTACTCCACATTACTCGAGTAATGTGGAGTAGAAATGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138712.x-892s1c1
Sequence:CCGGGACAACAGACAAATCACCATTCTCGAGAATGGTGATTTGTCTGTTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-1206s21c1
Sequence:CCGGATGGAGTCCACGAGATCATTTCTCGAGAAATGATCTCGTGGACTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-1388s21c1
Sequence:CCGGGACAGCGACTTGGCAATATTTCTCGAGAAATATTGCCAAGTCGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_138712.3-302s21c1
Sequence:CCGGTCCGTGGATCTCTCCGTAATGCTCGAGCATTACGGAGAGATCCACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011146
VALIDATED
PPARG MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011146.x-760s1c1
Sequence:CCGGGCCCTGGCAAAGCATTTGTATCTCGAGATACAAATGCTTTGCCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011146.x-1114s1c1
Sequence:CCGGGCCTCCCTGATGAATAAAGATCTCGAGATCTTTATTCATCAGGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011146.x-262s1c1
Sequence:CCGGGCTCCACACTATGAAGACATTCTCGAGAATGTCTTCATAGTGTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-766s21c1
Sequence:CCGGGCCCTGGCAAAGCATTTGTATCTCGAGATACAAATGCTTTGCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-234s21c1
Sequence:CCGGGCCCTTTACCACAGTTGATTTCTCGAGAAATCAACTGTGGTAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-268s21c1
Sequence:CCGGGCTCCACACTATGAAGACATTCTCGAGAATGTCTTCATAGTGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-1120s21c1
Sequence:CCGGGCCTCCCTGATGAATAAAGATCTCGAGATCTTTATTCATCAGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011146
VALIDATED
PPARG MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011146.x-760s1c1
Sequence:CCGGGCCCTGGCAAAGCATTTGTATCTCGAGATACAAATGCTTTGCCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011146.x-1114s1c1
Sequence:CCGGGCCTCCCTGATGAATAAAGATCTCGAGATCTTTATTCATCAGGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011146.x-262s1c1
Sequence:CCGGGCTCCACACTATGAAGACATTCTCGAGAATGTCTTCATAGTGTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-766s21c1
Sequence:CCGGGCCCTGGCAAAGCATTTGTATCTCGAGATACAAATGCTTTGCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-234s21c1
Sequence:CCGGGCCCTTTACCACAGTTGATTTCTCGAGAAATCAACTGTGGTAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-268s21c1
Sequence:CCGGGCTCCACACTATGAAGACATTCTCGAGAATGTCTTCATAGTGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-1120s21c1
Sequence:CCGGGCCTCCCTGATGAATAAAGATCTCGAGATCTTTATTCATCAGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011146
VALIDATED
PPARG MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011146.x-760s1c1
Sequence:CCGGGCCCTGGCAAAGCATTTGTATCTCGAGATACAAATGCTTTGCCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011146.x-1114s1c1
Sequence:CCGGGCCTCCCTGATGAATAAAGATCTCGAGATCTTTATTCATCAGGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011146.x-262s1c1
Sequence:CCGGGCTCCACACTATGAAGACATTCTCGAGAATGTCTTCATAGTGTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-766s21c1
Sequence:CCGGGCCCTGGCAAAGCATTTGTATCTCGAGATACAAATGCTTTGCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-234s21c1
Sequence:CCGGGCCCTTTACCACAGTTGATTTCTCGAGAAATCAACTGTGGTAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-268s21c1
Sequence:CCGGGCTCCACACTATGAAGACATTCTCGAGAATGTCTTCATAGTGTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011146.3-1120s21c1
Sequence:CCGGGCCTCCCTGATGAATAAAGATCTCGAGATCTTTATTCATCAGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)