EMAIL THIS PAGE TO A FRIEND

PPARGC1A

peroxisome proliferator-activated receptor gamma, coactivator 1 alpha

303 Gene Product Result for
Synonyms: LEM6 PGC-1(alpha) PGC-1v PGC1 PGC1A PPARGC1
UniProtKB ID: Q9UBK2, Q4W5M7, Q9UN32
Gene ID:
Human(10891) Summary: The protein encoded by this gene is a transcriptional coactivator that regulates the genes involved in energy metabolism. This protein interacts with PPARgamma, which permits the interaction of this protein with multiple transcription factors. This protein can interact with, and regulate the activities of, cAMP response element binding protein (CREB) and nuclear respiratory factors (NRFs). It provides a direct link between external physiological stimuli and the regulation of mitochondrial biogenesis, and is a major factor that regulates muscle fiber type determination. This protein may be also involved in controlling blood pressure, regulating cellular cholesterol homoeostasis, and the development of obesity. [provided by RefSeq, Jul 2008]
Mouse(19017) peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
Rat(83516) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
cow(338446) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
sheep(443270) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Goat(100861288) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
domestic guinea pig(100721512) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
naked mole-rat(101703716) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Domestic Rabbit(100349219) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Zebrafish(553418) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
chicken(422815) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
dog(479127) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Horse(100055716) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
domestic cat(101081802) peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0010891M3 Anti-PGC-1α antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4200209 Anti-PGC-1α antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human
western blot pricing
SAB4200226 Anti-PGC-1α(N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody Antibody Enhanced Validation human
western blot pricing
SAB2500781 Anti-PGC1A antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, rat, human
ELISA, western blot pricing
SAB1306113 ANTI-PPARGC antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
SAB2108526 Anti-PPARGC1A affinity isolated antibody human, mouse
western blot pricing
SAB2108742 Anti-PPARGC1A affinity isolated antibody rat, guinea pig, human, dog
immunofluorescence, western blot pricing
SAB1411910 ANTI-PPARGC1A antibody produced in mouse clone 3B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1411922 ANTI-PPARGC1A antibody produced in mouse clone 2F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA063136 Anti-PPARGC1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2106455 Anti-PPARGC1A antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, rat, dog, horse, human
western blot pricing
AV40129 Anti-PPARGC1A antibody produced in rabbit affinity isolated antibody human, pig, goat, horse, guinea pig, bovine, sheep, mouse, rabbit, canine, rat
western blot pricing
SAB2102979 Anti-PPARGC1A, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, bovine, guinea pig, human, rabbit, rat, canine, pig, mouse
western blot pricing
SAB5300223 Monoclonal Anti-PPARGC1A antibody produced in mouse clone 1G8, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013261 Rosetta Predictions human pricing
NM_031347 Rosetta Predictions rat pricing
NM_008904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063323 predicted 2280
2 SASI_Hs01_00063324 predicted 1577
3 SASI_Hs01_00063325 predicted 1373
4 SASI_Hs02_00344481 predicted 1064
5 SASI_Hs01_00063326 predicted 2018
6 SASI_Hs01_00063327 predicted 2233
7 SASI_Hs01_00063328 predicted 1482
8 SASI_Hs01_00063329 predicted 1547
9 SASI_Hs02_00344482 predicted 1595
10 SASI_Hs01_00063331 predicted 934
11 SASI_Hs01_00063330 predicted 1914
12 SASI_Hs01_00063332 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057042 predicted 587
2 SASI_Rn01_00057043 predicted 244
3 SASI_Rn01_00057044 predicted 1621
4 SASI_Rn01_00057045 predicted 1214
5 SASI_Rn01_00057046 predicted 1973
6 SASI_Rn01_00057047 predicted 1720
7 SASI_Rn02_00264582 predicted 1492
8 SASI_Rn01_00057048 predicted 2186
9 SASI_Rn01_00057049 predicted 865
10 SASI_Rn02_00264583 predicted 952
11 SASI_Rn01_00057050 predicted 860
12 SASI_Rn01_00057051 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082035 predicted 971
2 SASI_Mm01_00082036 predicted 1261
3 SASI_Mm02_00314924 predicted 628
4 SASI_Mm01_00082037 predicted 1876
5 SASI_Mm01_00082038 predicted 916
6 SASI_Mm01_00082039 predicted 639
7 SASI_Mm01_00082040 predicted 905
8 SASI_Mm01_00082041 predicted 1862
9 SASI_Mm01_00082042 predicted 1611
10 SASI_Mm01_00082044 predicted 1520
11 SASI_Mm01_00082043 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013261
PPARGC1A MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-2020s21c1
Sequence:CCGGTATGACAGCTACGAGGAATATCTCGAGATATTCCTCGTAGCTGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-1849s21c1
Sequence:CCGGTCGTGTTCCCGATCACCATATCTCGAGATATGGTGATCGGGAACACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-2286s1c1
Sequence:CCGGCCGTTATACCTGTGATGCTTTCTCGAGAAAGCATCACAGGTATAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013261.3-2948s21c1
Sequence:CCGGTTCCATGAAGACACGCTTAAACTCGAGTTTAAGCGTGTCTTCATGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-1018s1c1
Sequence:CCGGCCTCCTCATAAAGCCAACCAACTCGAGTTGGTTGGCTTTATGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-252s1c1
Sequence:CCGGCGACTTGGATACAGACAGCTTCTCGAGAAGCTGTCTGTATCCAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-1273s21c1
Sequence:CCGGGACTATTGCCAGTCAATTAATCTCGAGATTAATTGACTGGCAATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-1657s1c1
Sequence:CCGGGACAGCGAAGATGAAAGTGATCTCGAGATCACTTTCATCTTCGCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013261.x-4291s1c1
Sequence:CCGGGCAGAGTATGACGATGGTATTCTCGAGAATACCATCGTCATACTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013261
PPARGC1A MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-2020s21c1
Sequence:CCGGTATGACAGCTACGAGGAATATCTCGAGATATTCCTCGTAGCTGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-1849s21c1
Sequence:CCGGTCGTGTTCCCGATCACCATATCTCGAGATATGGTGATCGGGAACACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-2286s1c1
Sequence:CCGGCCGTTATACCTGTGATGCTTTCTCGAGAAAGCATCACAGGTATAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013261.3-2948s21c1
Sequence:CCGGTTCCATGAAGACACGCTTAAACTCGAGTTTAAGCGTGTCTTCATGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-1018s1c1
Sequence:CCGGCCTCCTCATAAAGCCAACCAACTCGAGTTGGTTGGCTTTATGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-252s1c1
Sequence:CCGGCGACTTGGATACAGACAGCTTCTCGAGAAGCTGTCTGTATCCAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-1273s21c1
Sequence:CCGGGACTATTGCCAGTCAATTAATCTCGAGATTAATTGACTGGCAATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-1657s1c1
Sequence:CCGGGACAGCGAAGATGAAAGTGATCTCGAGATCACTTTCATCTTCGCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013261.x-4291s1c1
Sequence:CCGGGCAGAGTATGACGATGGTATTCTCGAGAATACCATCGTCATACTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013261
PPARGC1A MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-2020s21c1
Sequence:CCGGTATGACAGCTACGAGGAATATCTCGAGATATTCCTCGTAGCTGTCATATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-1849s21c1
Sequence:CCGGTCGTGTTCCCGATCACCATATCTCGAGATATGGTGATCGGGAACACGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-2286s1c1
Sequence:CCGGCCGTTATACCTGTGATGCTTTCTCGAGAAAGCATCACAGGTATAACGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013261.3-2948s21c1
Sequence:CCGGTTCCATGAAGACACGCTTAAACTCGAGTTTAAGCGTGTCTTCATGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-1018s1c1
Sequence:CCGGCCTCCTCATAAAGCCAACCAACTCGAGTTGGTTGGCTTTATGAGGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-252s1c1
Sequence:CCGGCGACTTGGATACAGACAGCTTCTCGAGAAGCTGTCTGTATCCAAGTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013261.3-1273s21c1
Sequence:CCGGGACTATTGCCAGTCAATTAATCTCGAGATTAATTGACTGGCAATAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013261.x-1657s1c1
Sequence:CCGGGACAGCGAAGATGAAAGTGATCTCGAGATCACTTTCATCTTCGCTGTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013261.x-4291s1c1
Sequence:CCGGGCAGAGTATGACGATGGTATTCTCGAGAATACCATCGTCATACTCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008904
VALIDATED
PPARGC1A MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008904.1-1601s21c1
Sequence:CCGGCTAGCCATGGATGGCCTATTTCTCGAGAAATAGGCCATCCATGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-921s21c1
Sequence:GTACCGGAGACTATTGAGCGAACCTTAACTCGAGTTAAGGTTCGCTCAATAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-2365s21c1
Sequence:GTACCGGTAACTATGCAGACCTAGATACCTCGAGGTATCTAGGTCTGCATAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-2669s1c1
Sequence:CCGGCCAGAACAAGAACAACGGTTTCTCGAGAAACCGTTGTTCTTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008904.1-2117s1c1
Sequence:CCGGCGTGTGATTTACGTTGGTAAACTCGAGTTTACCAACGTAAATCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-629s1c1
Sequence:CCGGGCCATTGTTAAGACCGAGAATCTCGAGATTCTCGGTCTTAACAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008904.1-1548s1c1
Sequence:CCGGGCGACTTCAGTAATGAACAATCTCGAGATTGTTCATTACTGAAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-907s1c1
Sequence:CCGGCCCATTTGAGAACAAGACTATCTCGAGATAGTCTTGTTCTCAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-2732s21c1
Sequence:CCGGTCCAGTAAGCACACGTTTATTCTCGAGAATAAACGTGTGCTTACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008904
VALIDATED
PPARGC1A MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008904.1-1601s21c1
Sequence:CCGGCTAGCCATGGATGGCCTATTTCTCGAGAAATAGGCCATCCATGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-921s21c1
Sequence:GTACCGGAGACTATTGAGCGAACCTTAACTCGAGTTAAGGTTCGCTCAATAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-2365s21c1
Sequence:GTACCGGTAACTATGCAGACCTAGATACCTCGAGGTATCTAGGTCTGCATAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-2669s1c1
Sequence:CCGGCCAGAACAAGAACAACGGTTTCTCGAGAAACCGTTGTTCTTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008904.1-2117s1c1
Sequence:CCGGCGTGTGATTTACGTTGGTAAACTCGAGTTTACCAACGTAAATCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-629s1c1
Sequence:CCGGGCCATTGTTAAGACCGAGAATCTCGAGATTCTCGGTCTTAACAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008904.1-1548s1c1
Sequence:CCGGGCGACTTCAGTAATGAACAATCTCGAGATTGTTCATTACTGAAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-907s1c1
Sequence:CCGGCCCATTTGAGAACAAGACTATCTCGAGATAGTCTTGTTCTCAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-2732s21c1
Sequence:CCGGTCCAGTAAGCACACGTTTATTCTCGAGAATAAACGTGTGCTTACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008904
VALIDATED
PPARGC1A MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008904.1-1601s21c1
Sequence:CCGGCTAGCCATGGATGGCCTATTTCTCGAGAAATAGGCCATCCATGGCTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000218958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-921s21c1
Sequence:GTACCGGAGACTATTGAGCGAACCTTAACTCGAGTTAAGGTTCGCTCAATAGTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-2365s21c1
Sequence:GTACCGGTAACTATGCAGACCTAGATACCTCGAGGTATCTAGGTCTGCATAGTTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-2669s1c1
Sequence:CCGGCCAGAACAAGAACAACGGTTTCTCGAGAAACCGTTGTTCTTGTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008904.1-2117s1c1
Sequence:CCGGCGTGTGATTTACGTTGGTAAACTCGAGTTTACCAACGTAAATCACACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-629s1c1
Sequence:CCGGGCCATTGTTAAGACCGAGAATCTCGAGATTCTCGGTCTTAACAATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008904.1-1548s1c1
Sequence:CCGGGCGACTTCAGTAATGAACAATCTCGAGATTGTTCATTACTGAAGTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008904.1-907s1c1
Sequence:CCGGCCCATTTGAGAACAAGACTATCTCGAGATAGTCTTGTTCTCAAATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000234017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008904.1-2732s21c1
Sequence:CCGGTCCAGTAAGCACACGTTTATTCTCGAGAATAAACGTGTGCTTACTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???