EMAIL THIS PAGE TO A FRIEND

PPARGC1B

peroxisome proliferator-activated receptor gamma, coactivator 1 beta

63 Gene Product Result for
Synonyms: ERRL1 PERC PGC-1(beta) PGC1B
Gene ID:
Human(133522) Summary: The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(170826) peroxisome proliferative activated receptor, gamma, coactivator 1 beta
Rat(291567) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Zebrafish(555906) peroxisome proliferative activated receptor, gamma, coactivator 1, beta
chicken(416148) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
dog(489190) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Horse(100060526) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
domestic cat(101087453) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
naked mole-rat(101717446) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
domestic guinea pig(100724789) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
cow(514750) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
sheep(101121771) peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151721 MISSION® esiRNA esiRNA human PPARGC1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133263 Rosetta Predictions human pricing
NM_176075 Rosetta Predictions rat pricing
NM_133249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212923 predicted 2015
2 SASI_Hs01_00212924 predicted 2990
3 SASI_Hs01_00212926 predicted 1912
4 SASI_Hs01_00212927 predicted 1080
5 SASI_Hs01_00212928 predicted 2801
6 SASI_Hs01_00212929 predicted 900
7 SASI_Hs01_00212930 predicted 674
8 SASI_Hs01_00212931 predicted 669
9 SASI_Hs02_00362964 predicted 1913
10 SASI_Hs01_00212932 predicted 1804
11 SASI_Hs01_00212925 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103800 predicted 809
2 SASI_Rn01_00103801 predicted 2082
3 SASI_Rn01_00103802 predicted 566
4 SASI_Rn01_00103803 predicted 939
5 SASI_Rn01_00103804 predicted 1928
6 SASI_Rn02_00269557 predicted 310
7 SASI_Rn01_00103805 predicted 379
8 SASI_Rn01_00103807 predicted 2599
9 SASI_Rn01_00103808 predicted 558
10 SASI_Rn01_00103809 predicted 973
11 SASI_Rn01_00103806 predicted 2702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041354 predicted 935
2 SASI_Mm01_00041355 predicted 689
3 SASI_Mm01_00041356 predicted 2727
4 SASI_Mm01_00041357 predicted 1065
5 SASI_Mm01_00041358 predicted 2763
6 SASI_Mm01_00041359 predicted 312
7 SASI_Mm01_00041360 predicted 1681
8 SASI_Mm01_00041361 predicted 907
9 SASI_Mm01_00041362 predicted 1101
10 SASI_Mm01_00041363 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133263
PPARGC1B MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-235s1c1
Sequence:CCGGCCAGAGAACTCAGAGACTGAACTCGAGTTCAGTCTCTGAGTTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-2995s1c1
Sequence:CCGGCCCAGATACACTGACTACGATCTCGAGATCGTAGTCAGTGTATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133263.2-3127s1c1
Sequence:CCGGCCCTCGAGGAATACCTCAATACTCGAGTATTGAGGTATTCCTCGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-1917s1c1
Sequence:CCGGGCATAGTCTAGGCAAAGAAATCTCGAGATTTCTTTGCCTAGACTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-2398s1c1
Sequence:CCGGCCTGAGTATGACACTGTCTTTCTCGAGAAAGACAGTGTCATACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133263.2-140s21c1
Sequence:CCGGAGCAACTCTATGCTGACTTTCCTCGAGGAAAGTCAGCATAGAGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133263
PPARGC1B MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-235s1c1
Sequence:CCGGCCAGAGAACTCAGAGACTGAACTCGAGTTCAGTCTCTGAGTTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-2995s1c1
Sequence:CCGGCCCAGATACACTGACTACGATCTCGAGATCGTAGTCAGTGTATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133263.2-3127s1c1
Sequence:CCGGCCCTCGAGGAATACCTCAATACTCGAGTATTGAGGTATTCCTCGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-1917s1c1
Sequence:CCGGGCATAGTCTAGGCAAAGAAATCTCGAGATTTCTTTGCCTAGACTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-2398s1c1
Sequence:CCGGCCTGAGTATGACACTGTCTTTCTCGAGAAAGACAGTGTCATACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133263.2-140s21c1
Sequence:CCGGAGCAACTCTATGCTGACTTTCCTCGAGGAAAGTCAGCATAGAGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133263
PPARGC1B MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-235s1c1
Sequence:CCGGCCAGAGAACTCAGAGACTGAACTCGAGTTCAGTCTCTGAGTTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-2995s1c1
Sequence:CCGGCCCAGATACACTGACTACGATCTCGAGATCGTAGTCAGTGTATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133263.2-3127s1c1
Sequence:CCGGCCCTCGAGGAATACCTCAATACTCGAGTATTGAGGTATTCCTCGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-1917s1c1
Sequence:CCGGGCATAGTCTAGGCAAAGAAATCTCGAGATTTCTTTGCCTAGACTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133263.2-2398s1c1
Sequence:CCGGCCTGAGTATGACACTGTCTTTCTCGAGAAAGACAGTGTCATACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133263.2-140s21c1
Sequence:CCGGAGCAACTCTATGCTGACTTTCCTCGAGGAAAGTCAGCATAGAGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133249
VALIDATED
PPARGC1B MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-1306s21c1
Sequence:CCGGGGAGGTGAAACGGGATGTTAACTCGAGTTAACATCCCGTTTCACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133249.1-3156s1c1
Sequence:CCGGCCTTCCAATATGTTTACGTTTCTCGAGAAACGTAAACATATTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-2783s1c1
Sequence:CCGGCGGGAACTAAAGAAGCGCTTTCTCGAGAAAGCGCTTCTTTAGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-1079s1c1
Sequence:CCGGGAGTTCTCTATCCTAAGGGAACTCGAGTTCCCTTAGGATAGAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-517s1c1
Sequence:CCGGCGAGCTTTCACTGCTACAGAACTCGAGTTCTGTAGCAGTGAAAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-2393s1c1
Sequence:CCGGCCGGAGTATGACACCGTATTTCTCGAGAAATACGGTGTCATACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-1111s21c1
Sequence:CCGGAGATATCCTCTGTGATGTTAGCTCGAGCTAACATCACAGAGGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2831s21c1
Sequence:CCGGCAGGTGCTGACGAGAAGTAAACTCGAGTTTACTTCTCGTCAGCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-108s21c1
Sequence:CCGGCGTCCTTCTTCCTCAACTATCCTCGAGGATAGTTGAGGAAGAAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2773s21c1
Sequence:CCGGCATGAGCTCTCGGGAACTAAACTCGAGTTTAGTTCCCGAGAGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133249.2-3115s21c1
Sequence:CCGGGCCTTAACCTTCGAGGAATACCTCGAGGTATTCCTCGAAGGTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133249.2-2741s21c1
Sequence:CCGGCGTGTGGTATACATTCGAAATCTCGAGATTTCGAATGTATACCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2394s21c1
Sequence:CCGGCGGAGTATGACACCGTATTTGCTCGAGCAAATACGGTGTCATACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133249
VALIDATED
PPARGC1B MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-1306s21c1
Sequence:CCGGGGAGGTGAAACGGGATGTTAACTCGAGTTAACATCCCGTTTCACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133249.1-3156s1c1
Sequence:CCGGCCTTCCAATATGTTTACGTTTCTCGAGAAACGTAAACATATTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-2783s1c1
Sequence:CCGGCGGGAACTAAAGAAGCGCTTTCTCGAGAAAGCGCTTCTTTAGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-1079s1c1
Sequence:CCGGGAGTTCTCTATCCTAAGGGAACTCGAGTTCCCTTAGGATAGAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-517s1c1
Sequence:CCGGCGAGCTTTCACTGCTACAGAACTCGAGTTCTGTAGCAGTGAAAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-2393s1c1
Sequence:CCGGCCGGAGTATGACACCGTATTTCTCGAGAAATACGGTGTCATACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-1111s21c1
Sequence:CCGGAGATATCCTCTGTGATGTTAGCTCGAGCTAACATCACAGAGGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2831s21c1
Sequence:CCGGCAGGTGCTGACGAGAAGTAAACTCGAGTTTACTTCTCGTCAGCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-108s21c1
Sequence:CCGGCGTCCTTCTTCCTCAACTATCCTCGAGGATAGTTGAGGAAGAAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2773s21c1
Sequence:CCGGCATGAGCTCTCGGGAACTAAACTCGAGTTTAGTTCCCGAGAGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133249.2-3115s21c1
Sequence:CCGGGCCTTAACCTTCGAGGAATACCTCGAGGTATTCCTCGAAGGTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133249.2-2741s21c1
Sequence:CCGGCGTGTGGTATACATTCGAAATCTCGAGATTTCGAATGTATACCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2394s21c1
Sequence:CCGGCGGAGTATGACACCGTATTTGCTCGAGCAAATACGGTGTCATACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133249
VALIDATED
PPARGC1B MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma, coactivator 1 beta
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-1306s21c1
Sequence:CCGGGGAGGTGAAACGGGATGTTAACTCGAGTTAACATCCCGTTTCACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133249.1-3156s1c1
Sequence:CCGGCCTTCCAATATGTTTACGTTTCTCGAGAAACGTAAACATATTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-2783s1c1
Sequence:CCGGCGGGAACTAAAGAAGCGCTTTCTCGAGAAAGCGCTTCTTTAGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-1079s1c1
Sequence:CCGGGAGTTCTCTATCCTAAGGGAACTCGAGTTCCCTTAGGATAGAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-517s1c1
Sequence:CCGGCGAGCTTTCACTGCTACAGAACTCGAGTTCTGTAGCAGTGAAAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133249.1-2393s1c1
Sequence:CCGGCCGGAGTATGACACCGTATTTCTCGAGAAATACGGTGTCATACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-1111s21c1
Sequence:CCGGAGATATCCTCTGTGATGTTAGCTCGAGCTAACATCACAGAGGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2831s21c1
Sequence:CCGGCAGGTGCTGACGAGAAGTAAACTCGAGTTTACTTCTCGTCAGCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-108s21c1
Sequence:CCGGCGTCCTTCTTCCTCAACTATCCTCGAGGATAGTTGAGGAAGAAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2773s21c1
Sequence:CCGGCATGAGCTCTCGGGAACTAAACTCGAGTTTAGTTCCCGAGAGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133249.2-3115s21c1
Sequence:CCGGGCCTTAACCTTCGAGGAATACCTCGAGGTATTCCTCGAAGGTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133249.2-2741s21c1
Sequence:CCGGCGTGTGGTATACATTCGAAATCTCGAGATTTCGAATGTATACCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133249.2-2394s21c1
Sequence:CCGGCGGAGTATGACACCGTATTTGCTCGAGCAAATACGGTGTCATACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)