EMAIL THIS PAGE TO A FRIEND

PPAT

phosphoribosyl pyrophosphate amidotransferase

124 Gene Product Result for
Synonyms: ATASE GPAT PRAT
UniProtKB ID: Q06203
Gene ID:
Human(5471) Summary: The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Mouse(231327) phosphoribosyl pyrophosphate amidotransferase
Rat(117544) phosphoribosyl pyrophosphate amidotransferase
cow(509652) phosphoribosyl pyrophosphate amidotransferase
sheep(101109095) phosphoribosyl pyrophosphate amidotransferase
domestic guinea pig(100730194) phosphoribosyl pyrophosphate amidotransferase
naked mole-rat(101720775) phosphoribosyl pyrophosphate amidotransferase
Domestic Rabbit(100348590) phosphoribosyl pyrophosphate amidotransferase
Zebrafish(572027) phosphoribosyl pyrophosphate amidotransferase
chicken(422743) phosphoribosyl pyrophosphate amidotransferase
domestic cat(101084957) phosphoribosyl pyrophosphate amidotransferase
Horse(100053805) phosphoribosyl pyrophosphate amidotransferase
dog(611407) phosphoribosyl pyrophosphate amidotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002703 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_973973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_973973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_973973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002703 siRNAs that have been validated in the lab human pricing
XM_001076038 Rosetta Predictions rat pricing
XM_579602 Rosetta Predictions rat pricing
XM_001002879 Rosetta Predictions mouse pricing
XM_001002886 Rosetta Predictions mouse pricing
XM_896000 Rosetta Predictions mouse pricing
XM_924520 Rosetta Predictions mouse pricing
XM_973937 Rosetta Predictions mouse pricing
XM_973973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002703 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227769 validated 569
1 SASI_Hs01_00227770 validated 1322
1 SASI_Hs01_00227771 validated 337
2 SASI_Hs02_00334283 predicted 907
3 SASI_Hs02_00334284 predicted 823
4 SASI_Hs01_00227773 predicted 522
5 SASI_Hs01_00227774 predicted 1386
6 SASI_Hs01_00227775 predicted 795
7 SASI_Hs01_00227776 predicted 1558
8 SASI_Hs02_00334285 predicted 1571
9 SASI_Hs01_00227772 predicted 622
10 SASI_Hs01_00227777 predicted 1296
11 SASI_Hs01_00227778 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351885 predicted 1741
2 SASI_Rn02_00351886 predicted 2199
3 SASI_Rn02_00351887 predicted 1899
4 SASI_Rn02_00351888 predicted 1074
5 SASI_Rn02_00351889 predicted 1034
6 SASI_Rn02_00351890 predicted 1569
7 SASI_Rn02_00351891 predicted 2150
8 SASI_Rn02_00351892 predicted 789
9 SASI_Rn02_00351893 predicted 1166
10 SASI_Rn02_00351894 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408596 predicted 1740
2 SASI_Rn02_00408597 predicted 1748
3 SASI_Rn02_00408598 predicted 2201
4 SASI_Rn02_00408599 predicted 1901
5 SASI_Rn02_00408600 predicted 1067
6 SASI_Rn02_00408601 predicted 1042
7 SASI_Rn02_00408602 predicted 2147
8 SASI_Rn02_00408603 predicted 789
9 SASI_Rn02_00408604 predicted 1168
10 SASI_Rn02_00408605 predicted 1975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355624 predicted 2173
2 SASI_Mm02_00355625 predicted 1877
3 SASI_Mm02_00355626 predicted 1632
4 SASI_Mm02_00355627 predicted 1333
5 SASI_Mm02_00355628 predicted 1848
6 SASI_Mm02_00355629 predicted 1613
7 SASI_Mm02_00355630 predicted 1305
8 SASI_Mm02_00355631 predicted 668
9 SASI_Mm02_00355632 predicted 1724
10 SASI_Mm02_00355633 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355634 predicted 2161
2 SASI_Mm02_00355635 predicted 1865
3 SASI_Mm02_00355636 predicted 1617
4 SASI_Mm02_00355637 predicted 1321
5 SASI_Mm02_00355638 predicted 1831
6 SASI_Mm02_00355639 predicted 1595
7 SASI_Mm02_00355640 predicted 1287
8 SASI_Mm02_00355641 predicted 663
9 SASI_Mm02_00355642 predicted 1706
10 SASI_Mm02_00355643 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221191 predicted 2020
2 SASI_Mm02_00429706 predicted 1960
3 SASI_Mm01_00221192 predicted 1766
4 SASI_Mm01_00221193 predicted 1473
5 SASI_Mm01_00221194 predicted 1425
6 SASI_Mm01_00221195 predicted 1983
7 SASI_Mm01_00221196 predicted 1753
8 SASI_Mm01_00221197 predicted 1448
9 SASI_Mm02_00429707 predicted 1960
10 SASI_Mm01_00221198 predicted 2038
11 SASI_Mm01_00221199 predicted 1835
12 SASI_Mm01_00221200 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444189 predicted 2311
2 SASI_Mm02_00444190 predicted 2026
3 SASI_Mm02_00444191 predicted 2181
4 SASI_Mm02_00444192 predicted 1774
5 SASI_Mm02_00444193 predicted 1474
6 SASI_Mm02_00444194 predicted 1187
7 SASI_Mm02_00444195 predicted 1987
8 SASI_Mm02_00444196 predicted 1754
9 SASI_Mm02_00444197 predicted 1450
10 SASI_Mm02_00444198 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242339 predicted 1884
2 SASI_Mm02_00445179 predicted 1819
3 SASI_Mm01_00242340 predicted 1627
4 SASI_Mm01_00242341 predicted 1847
5 SASI_Mm01_00242343 predicted 1610
6 SASI_Mm01_00242344 predicted 1889
7 SASI_Mm01_00242345 predicted 1549
8 SASI_Mm01_00242346 predicted 1728
9 SASI_Mm01_00242347 predicted 1577
10 SASI_Mm01_00242348 predicted 1686
11 SASI_Mm01_00242342 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219001 predicted 1867
2 SASI_Mm02_00445200 predicted 1808
3 SASI_Mm01_00219002 predicted 1616
4 SASI_Mm01_00219003 predicted 1319
5 SASI_Mm01_00219004 predicted 1262
6 SASI_Mm01_00219005 predicted 1831
7 SASI_Mm01_00219006 predicted 1601
8 SASI_Mm01_00219007 predicted 1293
9 SASI_Mm02_00445201 predicted 1807
10 SASI_Mm01_00219008 predicted 1878
11 SASI_Mm01_00219009 predicted 1679
12 SASI_Mm01_00219010 predicted 1557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002703
VALIDATED
PPAT MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate amidotransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1813s21c1
Sequence:CCGGTGGTCACACCTCATCTATTTACTCGAGTAAATAGATGAGGTGTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1387s21c1
Sequence:CCGGCAATACCATCTCACCTATAATCTCGAGATTATAGGTGAGATGGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-576s21c1
Sequence:CCGGTGGTAAATGCTGCTCGATTAACTCGAGTTAATCGAGCAGCATTTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-521s21c1
Sequence:CCGGCCCTTCGTTGTTGAAACACTTCTCGAGAAGTGTTTCAACAACGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1451s21c1
Sequence:CCGGGTAGCTTCACCACCAATTAAACTCGAGTTTAATTGGTGGTGAAGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-2209s1c1
Sequence:CCGGCCTGTCTAACTGTAGACAAATCTCGAGATTTGTCTACAGTTAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-1414s1c1
Sequence:CCGGGCTCAAAGAATCTGGTGCAAACTCGAGTTTGCACCAGATTCTTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002703.3-800s1c1
Sequence:CCGGCCTTATGGAAATCGTCCCTTACTCGAGTAAGGGACGATTTCCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002703.3-801s1c1
Sequence:CCGGCTTATGGAAATCGTCCCTTATCTCGAGATAAGGGACGATTTCCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-521s1c1
Sequence:CCGGCCCTTCGTTGTTGAAACACTTCTCGAGAAGTGTTTCAACAACGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002703
VALIDATED
PPAT MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate amidotransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1813s21c1
Sequence:CCGGTGGTCACACCTCATCTATTTACTCGAGTAAATAGATGAGGTGTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1387s21c1
Sequence:CCGGCAATACCATCTCACCTATAATCTCGAGATTATAGGTGAGATGGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-576s21c1
Sequence:CCGGTGGTAAATGCTGCTCGATTAACTCGAGTTAATCGAGCAGCATTTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-521s21c1
Sequence:CCGGCCCTTCGTTGTTGAAACACTTCTCGAGAAGTGTTTCAACAACGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1451s21c1
Sequence:CCGGGTAGCTTCACCACCAATTAAACTCGAGTTTAATTGGTGGTGAAGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-2209s1c1
Sequence:CCGGCCTGTCTAACTGTAGACAAATCTCGAGATTTGTCTACAGTTAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-1414s1c1
Sequence:CCGGGCTCAAAGAATCTGGTGCAAACTCGAGTTTGCACCAGATTCTTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002703.3-800s1c1
Sequence:CCGGCCTTATGGAAATCGTCCCTTACTCGAGTAAGGGACGATTTCCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002703.3-801s1c1
Sequence:CCGGCTTATGGAAATCGTCCCTTATCTCGAGATAAGGGACGATTTCCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-521s1c1
Sequence:CCGGCCCTTCGTTGTTGAAACACTTCTCGAGAAGTGTTTCAACAACGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002703
VALIDATED
PPAT MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate amidotransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1813s21c1
Sequence:CCGGTGGTCACACCTCATCTATTTACTCGAGTAAATAGATGAGGTGTGACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1387s21c1
Sequence:CCGGCAATACCATCTCACCTATAATCTCGAGATTATAGGTGAGATGGTATTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-576s21c1
Sequence:CCGGTGGTAAATGCTGCTCGATTAACTCGAGTTAATCGAGCAGCATTTACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-521s21c1
Sequence:CCGGCCCTTCGTTGTTGAAACACTTCTCGAGAAGTGTTTCAACAACGAAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002703.3-1451s21c1
Sequence:CCGGGTAGCTTCACCACCAATTAAACTCGAGTTTAATTGGTGGTGAAGCTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-2209s1c1
Sequence:CCGGCCTGTCTAACTGTAGACAAATCTCGAGATTTGTCTACAGTTAGACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-1414s1c1
Sequence:CCGGGCTCAAAGAATCTGGTGCAAACTCGAGTTTGCACCAGATTCTTTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002703.3-800s1c1
Sequence:CCGGCCTTATGGAAATCGTCCCTTACTCGAGTAAGGGACGATTTCCATAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002703.3-801s1c1
Sequence:CCGGCTTATGGAAATCGTCCCTTATCTCGAGATAAGGGACGATTTCCATAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002703.3-521s1c1
Sequence:CCGGCCCTTCGTTGTTGAAACACTTCTCGAGAAGTGTTTCAACAACGAAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_973973
PPAT MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate amidotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1246s21c1
Sequence:CCGGATCCATCGGTGCCAGATATTGCTCGAGCAATATCTGGCACCGATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_973973.2-2170s21c1
Sequence:CCGGCCACATGCTTATGTATGTATACTCGAGTATACATACATAAGCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1072s21c1
Sequence:CCGGAGCATACTCCCTGGTTATAATCTCGAGATTATAACCAGGGAGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1713s21c1
Sequence:CCGGATACTATCTCACCCATCATAACTCGAGTTATGATGGGTGAGATAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-700s21c1
Sequence:CCGGGCCTAAATTCAGGGTGCATAACTCGAGTTATGCACCCTGAATTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_973973
PPAT MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate amidotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1246s21c1
Sequence:CCGGATCCATCGGTGCCAGATATTGCTCGAGCAATATCTGGCACCGATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_973973.2-2170s21c1
Sequence:CCGGCCACATGCTTATGTATGTATACTCGAGTATACATACATAAGCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1072s21c1
Sequence:CCGGAGCATACTCCCTGGTTATAATCTCGAGATTATAACCAGGGAGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1713s21c1
Sequence:CCGGATACTATCTCACCCATCATAACTCGAGTTATGATGGGTGAGATAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-700s21c1
Sequence:CCGGGCCTAAATTCAGGGTGCATAACTCGAGTTATGCACCCTGAATTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_973973
PPAT MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate amidotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1246s21c1
Sequence:CCGGATCCATCGGTGCCAGATATTGCTCGAGCAATATCTGGCACCGATGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_973973.2-2170s21c1
Sequence:CCGGCCACATGCTTATGTATGTATACTCGAGTATACATACATAAGCATGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1072s21c1
Sequence:CCGGAGCATACTCCCTGGTTATAATCTCGAGATTATAACCAGGGAGTATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-1713s21c1
Sequence:CCGGATACTATCTCACCCATCATAACTCGAGTTATGATGGGTGAGATAGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_973973.2-700s21c1
Sequence:CCGGGCCTAAATTCAGGGTGCATAACTCGAGTTATGCACCCTGAATTTAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172146
VALIDATED
PPAT MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate amidotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-1333s1c1
Sequence:CCGGCCTCAAAGAATCCGGTGCAAACTCGAGTTTGCACCGGATTCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-555s1c1
Sequence:CCGGCCTCTGATAGTGAAATGATTACTCGAGTAATCATTTCACTATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-1765s1c1
Sequence:CCGGCCACATGCTTATGTATGTATACTCGAGTATACATACATAAGCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-295s1c1
Sequence:CCGGGCCTAAATTCAGGGTGCATAACTCGAGTTATGCACCCTGAATTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-876s1c1
Sequence:CCGGCCGGAGAAATTGTAGAAATATCTCGAGATATTTCTACAATTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172146
VALIDATED
PPAT MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate amidotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-1333s1c1
Sequence:CCGGCCTCAAAGAATCCGGTGCAAACTCGAGTTTGCACCGGATTCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-555s1c1
Sequence:CCGGCCTCTGATAGTGAAATGATTACTCGAGTAATCATTTCACTATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-1765s1c1
Sequence:CCGGCCACATGCTTATGTATGTATACTCGAGTATACATACATAAGCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-295s1c1
Sequence:CCGGGCCTAAATTCAGGGTGCATAACTCGAGTTATGCACCCTGAATTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-876s1c1
Sequence:CCGGCCGGAGAAATTGTAGAAATATCTCGAGATATTTCTACAATTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172146
VALIDATED
PPAT MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate amidotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-1333s1c1
Sequence:CCGGCCTCAAAGAATCCGGTGCAAACTCGAGTTTGCACCGGATTCTTTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000031617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-555s1c1
Sequence:CCGGCCTCTGATAGTGAAATGATTACTCGAGTAATCATTTCACTATCAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000031614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-1765s1c1
Sequence:CCGGCCACATGCTTATGTATGTATACTCGAGTATACATACATAAGCATGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000031615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-295s1c1
Sequence:CCGGGCCTAAATTCAGGGTGCATAACTCGAGTTATGCACCCTGAATTTAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000031618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172146.1-876s1c1
Sequence:CCGGCCGGAGAAATTGTAGAAATATCTCGAGATATTTCTACAATTTCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???