EMAIL THIS PAGE TO A FRIEND

PPBP

pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)

61 Gene Product Result for
Synonyms: B-TG1 Beta-TG CTAP-III CTAP3 CTAPIII CXCL7 LA-PF4 LDGF MDGF NAP-2 PBP SCYB7 TC1 TC2 TGB TGB1 THBGB THBGB1
UniProtKB ID: P02775, B2R5F3, Q6IBJ8
Gene ID:
Human(5473) Summary: The protein encoded by this gene is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. It has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. [provided by RefSeq, May 2010]
Mouse(57349) pro-platelet basic protein
Rat(246358) pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
dog(482196) pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
cow(613723) pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
sheep(101104151) pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002704 Rosetta Predictions human pricing
NM_153721 Rosetta Predictions rat pricing
NM_023785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148232 predicted 250
2 SASI_Hs01_00148233 predicted 335
3 SASI_Hs01_00148234 predicted 310
4 SASI_Hs01_00148235 predicted 334
5 SASI_Hs01_00148236 predicted 340
6 SASI_Hs01_00148237 predicted 194
7 SASI_Hs01_00148239 predicted 248
8 SASI_Hs01_00148240 predicted 331
9 SASI_Hs01_00148241 predicted 277
10 SASI_Hs02_00334286 predicted 304
11 SASI_Hs01_00148238 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082317 predicted 113
2 SASI_Rn01_00082318 predicted 137
3 SASI_Rn01_00082319 predicted 183
4 SASI_Rn01_00082320 predicted 124
5 SASI_Rn01_00082321 predicted 317
6 SASI_Rn01_00082322 predicted 160
7 SASI_Rn01_00082323 predicted 232
8 SASI_Rn01_00082325 predicted 150
9 SASI_Rn01_00082326 predicted 312
10 SASI_Rn02_00269010 predicted 13
11 SASI_Rn01_00082324 predicted 150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194058 predicted 258
2 SASI_Mm01_00194059 predicted 579
3 SASI_Mm01_00194060 predicted 620
4 SASI_Mm01_00194061 predicted 620
5 SASI_Mm01_00194062 predicted 258
6 SASI_Mm01_00194063 predicted 464
7 SASI_Mm01_00194064 predicted 237
8 SASI_Mm01_00194065 predicted 247
9 SASI_Mm01_00194066 predicted 617
10 SASI_Mm01_00194067 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023785
VALIDATED
PPBP MISSION shRNA Bacterial Glycerol Stock
pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023785.1-636s1c1
Sequence:CCGGCCTGCAATTTATGGTCTATTTCTCGAGAAATAGACCATAAATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-269s1c1
Sequence:CCGGCCATTCAATTCTATCTCCCTTCTCGAGAAGGGAGATAGAATTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-130s1c1
Sequence:CCGGCCCACTTCATAACCTCCAGATCTCGAGATCTGGAGGTTATGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-338s1c1
Sequence:CCGGGCCACACTGAAGAATGGACAACTCGAGTTGTCCATTCTTCAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-388s1c1
Sequence:CCGGCGTCAAGAGAATCGTCATGAACTCGAGTTCATGACGATTCTCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-338s21c1
Sequence:CCGGGCCACACTGAAGAATGGACAACTCGAGTTGTCCATTCTTCAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-130s21c1
Sequence:CCGGCCCACTTCATAACCTCCAGATCTCGAGATCTGGAGGTTATGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023785.2-636s21c1
Sequence:CCGGCCTGCAATTTATGGTCTATTTCTCGAGAAATAGACCATAAATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-388s21c1
Sequence:CCGGCGTCAAGAGAATCGTCATGAACTCGAGTTCATGACGATTCTCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-269s21c1
Sequence:CCGGCCATTCAATTCTATCTCCCTTCTCGAGAAGGGAGATAGAATTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023785
VALIDATED
PPBP MISSION shRNA shRNA Plasmid DNA
pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023785.1-636s1c1
Sequence:CCGGCCTGCAATTTATGGTCTATTTCTCGAGAAATAGACCATAAATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-269s1c1
Sequence:CCGGCCATTCAATTCTATCTCCCTTCTCGAGAAGGGAGATAGAATTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-130s1c1
Sequence:CCGGCCCACTTCATAACCTCCAGATCTCGAGATCTGGAGGTTATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-338s1c1
Sequence:CCGGGCCACACTGAAGAATGGACAACTCGAGTTGTCCATTCTTCAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-388s1c1
Sequence:CCGGCGTCAAGAGAATCGTCATGAACTCGAGTTCATGACGATTCTCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-338s21c1
Sequence:CCGGGCCACACTGAAGAATGGACAACTCGAGTTGTCCATTCTTCAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-130s21c1
Sequence:CCGGCCCACTTCATAACCTCCAGATCTCGAGATCTGGAGGTTATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023785.2-636s21c1
Sequence:CCGGCCTGCAATTTATGGTCTATTTCTCGAGAAATAGACCATAAATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-388s21c1
Sequence:CCGGCGTCAAGAGAATCGTCATGAACTCGAGTTCATGACGATTCTCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-269s21c1
Sequence:CCGGCCATTCAATTCTATCTCCCTTCTCGAGAAGGGAGATAGAATTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023785
VALIDATED
PPBP MISSION shRNA Lentiviral Transduction Particles
pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023785.1-636s1c1
Sequence:CCGGCCTGCAATTTATGGTCTATTTCTCGAGAAATAGACCATAAATTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-269s1c1
Sequence:CCGGCCATTCAATTCTATCTCCCTTCTCGAGAAGGGAGATAGAATTGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-130s1c1
Sequence:CCGGCCCACTTCATAACCTCCAGATCTCGAGATCTGGAGGTTATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-338s1c1
Sequence:CCGGGCCACACTGAAGAATGGACAACTCGAGTTGTCCATTCTTCAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023785.1-388s1c1
Sequence:CCGGCGTCAAGAGAATCGTCATGAACTCGAGTTCATGACGATTCTCTTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-338s21c1
Sequence:CCGGGCCACACTGAAGAATGGACAACTCGAGTTGTCCATTCTTCAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-130s21c1
Sequence:CCGGCCCACTTCATAACCTCCAGATCTCGAGATCTGGAGGTTATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023785.2-636s21c1
Sequence:CCGGCCTGCAATTTATGGTCTATTTCTCGAGAAATAGACCATAAATTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-388s21c1
Sequence:CCGGCGTCAAGAGAATCGTCATGAACTCGAGTTCATGACGATTCTCTTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023785.2-269s21c1
Sequence:CCGGCCATTCAATTCTATCTCCCTTCTCGAGAAGGGAGATAGAATTGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002704
PPBP MISSION shRNA Bacterial Glycerol Stock
pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-446s1c1
Sequence:CCGGAGGTGATGAATCTGCTGATTACTCGAGTAATCAGCAGATTCATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-325s1c1
Sequence:CCGGTGATCGGGAAAGGAACCCATTCTCGAGAATGGGTTCCTTTCCCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-345s1c1
Sequence:CCGGTGCAACCAAGTCGAAGTGATACTCGAGTATCACTTCGACTTGGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-308s1c1
Sequence:CCGGCATCCAAAGTTTGGAAGTGATCTCGAGATCACTTCCAAACTTTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-206s1c1
Sequence:CCGGGAGAAACTTGGCGAAAGGCAACTCGAGTTGCCTTTCGCCAAGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002704.2-497s21c1
Sequence:CCGGCTCCCAGGAAGGGTAGAATTTCTCGAGAAATTCTACCCTTCCTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002704.2-475s21c1
Sequence:CCGGTGTTTCTGCCAAACTTCTTTACTCGAGTAAAGAAGTTTGGCAGAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002704
PPBP MISSION shRNA shRNA Plasmid DNA
pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-446s1c1
Sequence:CCGGAGGTGATGAATCTGCTGATTACTCGAGTAATCAGCAGATTCATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-325s1c1
Sequence:CCGGTGATCGGGAAAGGAACCCATTCTCGAGAATGGGTTCCTTTCCCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-345s1c1
Sequence:CCGGTGCAACCAAGTCGAAGTGATACTCGAGTATCACTTCGACTTGGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-308s1c1
Sequence:CCGGCATCCAAAGTTTGGAAGTGATCTCGAGATCACTTCCAAACTTTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-206s1c1
Sequence:CCGGGAGAAACTTGGCGAAAGGCAACTCGAGTTGCCTTTCGCCAAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002704.2-497s21c1
Sequence:CCGGCTCCCAGGAAGGGTAGAATTTCTCGAGAAATTCTACCCTTCCTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002704.2-475s21c1
Sequence:CCGGTGTTTCTGCCAAACTTCTTTACTCGAGTAAAGAAGTTTGGCAGAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002704
PPBP MISSION shRNA Lentiviral Transduction Particles
pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-446s1c1
Sequence:CCGGAGGTGATGAATCTGCTGATTACTCGAGTAATCAGCAGATTCATCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-325s1c1
Sequence:CCGGTGATCGGGAAAGGAACCCATTCTCGAGAATGGGTTCCTTTCCCGATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-345s1c1
Sequence:CCGGTGCAACCAAGTCGAAGTGATACTCGAGTATCACTTCGACTTGGTTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-308s1c1
Sequence:CCGGCATCCAAAGTTTGGAAGTGATCTCGAGATCACTTCCAAACTTTGGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002704.2-206s1c1
Sequence:CCGGGAGAAACTTGGCGAAAGGCAACTCGAGTTGCCTTTCGCCAAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002704.2-497s21c1
Sequence:CCGGCTCCCAGGAAGGGTAGAATTTCTCGAGAAATTCTACCCTTCCTGGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002704.2-475s21c1
Sequence:CCGGTGTTTCTGCCAAACTTCTTTACTCGAGTAAAGAAGTTTGGCAGAAACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)