EMAIL THIS PAGE TO A FRIEND

PPCDC

phosphopantothenoylcysteine decarboxylase

48 Gene Product Result for
UniProtKB ID: Q96CD2, Q96SX0, Q9HC17
Gene ID:
Human(60490) Summary: Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]
Mouse(66812) phosphopantothenoylcysteine decarboxylase
Rat(363069) phosphopantothenoylcysteine decarboxylase
fruit fly(246533) Phosphopantothenoylcysteine decarboxylase
Zebrafish(393753) phosphopantothenoylcysteine decarboxylase
dog(487653) phosphopantothenoylcysteine decarboxylase
domestic cat(101084628) phosphopantothenoylcysteine decarboxylase
chicken(427477) phosphopantothenoylcysteine decarboxylase
cow(614957) phosphopantothenoylcysteine decarboxylase
sheep(101107138) phosphopantothenoylcysteine decarboxylase
domestic guinea pig(100712891) phosphopantothenoylcysteine decarboxylase
naked mole-rat(101715112) phosphopantothenoylcysteine decarboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021823 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021823 Rosetta Predictions human pricing
NM_001108763 Rosetta Predictions rat pricing
NM_176831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130931 predicted 575
2 SASI_Hs01_00130932 predicted 804
3 SASI_Hs02_00355134 predicted 1035
4 SASI_Hs01_00130933 predicted 326
5 SASI_Hs01_00130934 predicted 683
6 SASI_Hs01_00130935 predicted 666
7 SASI_Hs01_00130936 predicted 713
8 SASI_Hs01_00130937 predicted 759
9 SASI_Hs01_00130938 predicted 324
10 SASI_Hs02_00355135 predicted 504
11 SASI_Hs01_00130939 predicted 725
12 SASI_Hs01_00130940 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241845 predicted 624
2 SASI_Rn02_00241846 predicted 931
3 SASI_Rn02_00241847 predicted 643
4 SASI_Rn02_00241848 predicted 897
5 SASI_Rn02_00241849 predicted 1066
6 SASI_Rn02_00241850 predicted 1204
7 SASI_Rn02_00241851 predicted 313
8 SASI_Rn02_00241852 predicted 1174
9 SASI_Rn02_00241853 predicted 1007
10 SASI_Rn02_00241854 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136592 predicted 1238
2 SASI_Mm01_00136593 predicted 987
3 SASI_Mm01_00136595 predicted 900
4 SASI_Mm01_00136596 predicted 1202
5 SASI_Mm02_00346717 predicted 1216
6 SASI_Mm01_00136597 predicted 766
7 SASI_Mm02_00346718 predicted 912
8 SASI_Mm01_00136599 predicted 396
9 SASI_Mm01_00136600 predicted 895
10 SASI_Mm01_00136601 predicted 1254
11 SASI_Mm01_00136594 predicted 641
12 SASI_Mm01_00136598 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021823
VALIDATED
PPCDC MISSION shRNA Bacterial Glycerol Stock
phosphopantothenoylcysteine decarboxylase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021823.3-807s21c1
Sequence:CCGGATAGGAGGATACCCTCATTTGCTCGAGCAAATGAGGGTATCCTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-328s21c1
Sequence:CCGGACGCTGATGAATGGGAGATATCTCGAGATATCTCCCATTCATCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-457s1c1
Sequence:CCGGCAACTTGCTTACCTGCGTCATCTCGAGATGACGCAGGTAAGCAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-261s1c1
Sequence:CCGGCAACTGAGAGAGCCAAACATTCTCGAGAATGTTTGGCTCTCTCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-679s1c1
Sequence:CCGGGAAAGAAGTCCTCTTCCAGCACTCGAGTGCTGGAAGAGGACTTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-1088s1c1
Sequence:CCGGCCTTGGGAGTTTCAGCTCTTTCTCGAGAAAGAGCTGAAACTCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-464s21c1
Sequence:CCGGCAACTTGCTTACCTGCGTCATCTCGAGATGACGCAGGTAAGCAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-686s21c1
Sequence:CCGGGAAAGAAGTCCTCTTCCAGCACTCGAGTGCTGGAAGAGGACTTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-210s21c1
Sequence:CCGGTTGCCTCTTCTGGTGTCAAAGCTCGAGCTTTGACACCAGAAGAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-442s1c1
Sequence:CCGGCAGTGGCATCTGTGACAACTTCTCGAGAAGTTGTCACAGATGCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-673s1c1
Sequence:CCGGCAAAGTGAAAGAAGTCCTCTTCTCGAGAAGAGGACTTCTTTCACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-245s1c1
Sequence:CCGGGAAGTATCAGTGGTCACAACTCTCGAGAGTTGTGACCACTGATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021823.2-1608s1c1
Sequence:CCGGCCAGAGAGCTTTCCTAGCATTCTCGAGAATGCTAGGAAAGCTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-667s1c1
Sequence:CCGGCGTGGACAAAGTGAAAGAAGTCTCGAGACTTCTTTCACTTTGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021823
VALIDATED
PPCDC MISSION shRNA shRNA Plasmid DNA
phosphopantothenoylcysteine decarboxylase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021823.3-807s21c1
Sequence:CCGGATAGGAGGATACCCTCATTTGCTCGAGCAAATGAGGGTATCCTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-328s21c1
Sequence:CCGGACGCTGATGAATGGGAGATATCTCGAGATATCTCCCATTCATCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-457s1c1
Sequence:CCGGCAACTTGCTTACCTGCGTCATCTCGAGATGACGCAGGTAAGCAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-261s1c1
Sequence:CCGGCAACTGAGAGAGCCAAACATTCTCGAGAATGTTTGGCTCTCTCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-679s1c1
Sequence:CCGGGAAAGAAGTCCTCTTCCAGCACTCGAGTGCTGGAAGAGGACTTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-1088s1c1
Sequence:CCGGCCTTGGGAGTTTCAGCTCTTTCTCGAGAAAGAGCTGAAACTCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-464s21c1
Sequence:CCGGCAACTTGCTTACCTGCGTCATCTCGAGATGACGCAGGTAAGCAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-686s21c1
Sequence:CCGGGAAAGAAGTCCTCTTCCAGCACTCGAGTGCTGGAAGAGGACTTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-210s21c1
Sequence:CCGGTTGCCTCTTCTGGTGTCAAAGCTCGAGCTTTGACACCAGAAGAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-442s1c1
Sequence:CCGGCAGTGGCATCTGTGACAACTTCTCGAGAAGTTGTCACAGATGCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-673s1c1
Sequence:CCGGCAAAGTGAAAGAAGTCCTCTTCTCGAGAAGAGGACTTCTTTCACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-245s1c1
Sequence:CCGGGAAGTATCAGTGGTCACAACTCTCGAGAGTTGTGACCACTGATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021823.2-1608s1c1
Sequence:CCGGCCAGAGAGCTTTCCTAGCATTCTCGAGAATGCTAGGAAAGCTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-667s1c1
Sequence:CCGGCGTGGACAAAGTGAAAGAAGTCTCGAGACTTCTTTCACTTTGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021823
VALIDATED
PPCDC MISSION shRNA Lentiviral Transduction Particles
phosphopantothenoylcysteine decarboxylase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021823.3-807s21c1
Sequence:CCGGATAGGAGGATACCCTCATTTGCTCGAGCAAATGAGGGTATCCTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-328s21c1
Sequence:CCGGACGCTGATGAATGGGAGATATCTCGAGATATCTCCCATTCATCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-457s1c1
Sequence:CCGGCAACTTGCTTACCTGCGTCATCTCGAGATGACGCAGGTAAGCAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-261s1c1
Sequence:CCGGCAACTGAGAGAGCCAAACATTCTCGAGAATGTTTGGCTCTCTCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-679s1c1
Sequence:CCGGGAAAGAAGTCCTCTTCCAGCACTCGAGTGCTGGAAGAGGACTTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021823.2-1088s1c1
Sequence:CCGGCCTTGGGAGTTTCAGCTCTTTCTCGAGAAAGAGCTGAAACTCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-464s21c1
Sequence:CCGGCAACTTGCTTACCTGCGTCATCTCGAGATGACGCAGGTAAGCAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-686s21c1
Sequence:CCGGGAAAGAAGTCCTCTTCCAGCACTCGAGTGCTGGAAGAGGACTTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021823.3-210s21c1
Sequence:CCGGTTGCCTCTTCTGGTGTCAAAGCTCGAGCTTTGACACCAGAAGAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-442s1c1
Sequence:CCGGCAGTGGCATCTGTGACAACTTCTCGAGAAGTTGTCACAGATGCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-673s1c1
Sequence:CCGGCAAAGTGAAAGAAGTCCTCTTCTCGAGAAGAGGACTTCTTTCACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-245s1c1
Sequence:CCGGGAAGTATCAGTGGTCACAACTCTCGAGAGTTGTGACCACTGATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021823.2-1608s1c1
Sequence:CCGGCCAGAGAGCTTTCCTAGCATTCTCGAGAATGCTAGGAAAGCTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021823.2-667s1c1
Sequence:CCGGCGTGGACAAAGTGAAAGAAGTCTCGAGACTTCTTTCACTTTGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176831
VALIDATED
PPCDC MISSION shRNA Bacterial Glycerol Stock
phosphopantothenoylcysteine decarboxylase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000257833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176831.4-366s21c1
Sequence:CCGGCTACAGTGACGCTGATGAATGCTCGAGCATTCATCAGCGTCACTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-1038s21c1
Sequence:CCGGCTGCTACTGGAAGGGTAATTGCTCGAGCAATTACCCTTCCAGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-256s21c1
Sequence:CCGGCTGCCTCTCCTGGTATCTAAGCTCGAGCTTAGATACCAGGAGAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-632s21c1
Sequence:CCGGCCTTTGGCTACGTGGAGATTCCTCGAGGAATCTCCACGTAGCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176831
VALIDATED
PPCDC MISSION shRNA shRNA Plasmid DNA
phosphopantothenoylcysteine decarboxylase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000257833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176831.4-366s21c1
Sequence:CCGGCTACAGTGACGCTGATGAATGCTCGAGCATTCATCAGCGTCACTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-1038s21c1
Sequence:CCGGCTGCTACTGGAAGGGTAATTGCTCGAGCAATTACCCTTCCAGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-256s21c1
Sequence:CCGGCTGCCTCTCCTGGTATCTAAGCTCGAGCTTAGATACCAGGAGAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-632s21c1
Sequence:CCGGCCTTTGGCTACGTGGAGATTCCTCGAGGAATCTCCACGTAGCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176831
VALIDATED
PPCDC MISSION shRNA Lentiviral Transduction Particles
phosphopantothenoylcysteine decarboxylase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000257833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176831.4-366s21c1
Sequence:CCGGCTACAGTGACGCTGATGAATGCTCGAGCATTCATCAGCGTCACTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-1038s21c1
Sequence:CCGGCTGCTACTGGAAGGGTAATTGCTCGAGCAATTACCCTTCCAGTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-256s21c1
Sequence:CCGGCTGCCTCTCCTGGTATCTAAGCTCGAGCTTAGATACCAGGAGAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176831.4-632s21c1
Sequence:CCGGCCTTTGGCTACGTGGAGATTCCTCGAGGAATCTCCACGTAGCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)