EMAIL THIS PAGE TO A FRIEND

PPCS

phosphopantothenoylcysteine synthetase

102 Gene Product Result for
UniProtKB ID: Q9HAB8, Q3KQT2, Q5VVM0
Gene ID:
Human(79717) Summary: Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCS (EC 6.3.2.5), one of the last enzymes in this pathway, converts phosphopantothenate to phosphopantothenoylcysteine (Daugherty et al., 2002 [PubMed 11923312]
Mouse(106564) phosphopantothenoylcysteine synthetase
Rat(298490) phosphopantothenoylcysteine synthetase
fruit fly(42295) Phosphopantothenoylcysteine synthetase
domestic cat(101093376) phosphopantothenoylcysteine synthetase
dog(475309) phosphopantothenoylcysteine synthetase
chicken(100859789) phosphopantothenoylcysteine synthetase
Zebrafish(561272) phosphopantothenoylcysteine synthetase
naked mole-rat(101722213) phosphopantothenoylcysteine synthetase
domestic guinea pig(100713605) phosphopantothenoylcysteine synthetase
cow(539294) phosphopantothenoylcysteine synthetase
sheep(100145879) phosphopantothenoylcysteine synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024664 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077447 Rosetta Predictions human pricing
NM_024664 Rosetta Predictions human pricing
NM_001039010 Rosetta Predictions rat pricing
NM_026494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312604 predicted 366
2 SASI_Hs02_00312605 predicted 341
3 SASI_Hs02_00312606 predicted 346
4 SASI_Hs02_00312607 predicted 372
5 SASI_Hs02_00312608 predicted 377
6 SASI_Hs02_00312609 predicted 385
7 SASI_Hs02_00312610 predicted 335
8 SASI_Hs02_00312611 predicted 352
9 SASI_Hs02_00312612 predicted 367
10 SASI_Hs02_00312613 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357066 predicted 812
2 SASI_Hs02_00357067 predicted 781
3 SASI_Hs01_00058318 predicted 793
4 SASI_Hs01_00058319 predicted 814
5 SASI_Hs02_00357068 predicted 828
6 SASI_Hs02_00357069 predicted 828
7 SASI_Hs02_00357070 predicted 780
8 SASI_Hs02_00357071 predicted 791
9 SASI_Hs02_00357072 predicted 813
10 SASI_Hs02_00357073 predicted 797
11 SASI_Hs01_00058311 predicted 673
12 SASI_Hs01_00058312 predicted 440
13 SASI_Hs01_00058313 predicted 333
14 SASI_Hs01_00058314 predicted 430
15 SASI_Hs01_00058315 predicted 745
16 SASI_Hs01_00058316 predicted 625
17 SASI_Hs01_00058317 predicted 372
18 SASI_Hs01_00058320 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204735 predicted 787
2 SASI_Rn01_00059554 predicted 456
3 SASI_Rn02_00204736 predicted 740
4 SASI_Rn01_00059556 predicted 667
5 SASI_Rn02_00204737 predicted 494
6 SASI_Rn02_00204738 predicted 767
7 SASI_Rn02_00204739 predicted 973
8 SASI_Rn02_00204740 predicted 973
9 SASI_Rn02_00204741 predicted 845
10 SASI_Rn02_00204742 predicted 543
11 SASI_Rn01_00059555 predicted 910
12 SASI_Rn01_00059557 predicted 1387
13 SASI_Rn01_00059558 predicted 885
14 SASI_Rn01_00059559 predicted 1212
15 SASI_Rn01_00059560 predicted 522
16 SASI_Rn01_00059561 predicted 1347
17 SASI_Rn01_00059562 predicted 722
18 SASI_Rn01_00059563 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107149 predicted 491
2 SASI_Mm01_00107150 predicted 733
3 SASI_Mm01_00107151 predicted 717
4 SASI_Mm01_00107152 predicted 562
5 SASI_Mm01_00107153 predicted 829
6 SASI_Mm01_00107154 predicted 1027
7 SASI_Mm01_00107155 predicted 1045
8 SASI_Mm01_00107156 predicted 1001
9 SASI_Mm01_00107157 predicted 891
10 SASI_Mm02_00330383 predicted 506
11 SASI_Mm01_00107148 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024664
VALIDATED
PPCS MISSION shRNA Bacterial Glycerol Stock
phosphopantothenoylcysteine synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024664.1-828s1c1
Sequence:CCGGCGGAAACCAAGTTATTGCTATCTCGAGATAGCAATAACTTGGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024664.1-734s1c1
Sequence:CCGGGCTCGGAAGGCTTTGGAAATTCTCGAGAATTTCCAAAGCCTTCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024664.2-1268s21c1
Sequence:CCGGGCCTGAATGTCAGCCATCTTTCTCGAGAAAGATGGCTGACATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024664.1-1210s1c1
Sequence:CCGGGCCTGAATGTCAGCCATCTTTCTCGAGAAAGATGGCTGACATTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024664.2-602s21c1
Sequence:CCGGGCTGTGTCAGATTTCTATGTTCTCGAGAACATAGAAATCTGACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024664.2-928s21c1
Sequence:CCGGCGTAGAGATAGAAGAGAAGATCTCGAGATCTTCTCTTCTATCTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024664.1-653s1c1
Sequence:CCGGCCTTTGGTTAAAGATTGGGCTCTCGAGAGCCCAATCTTTAACCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024664.1-870s1c1
Sequence:CCGGCGTAGAGATAGAAGAGAAGATCTCGAGATCTTCTCTTCTATCTCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024664.1-545s1c1
Sequence:CCGGGCTGTGTCAGATTTCTATGTTCTCGAGAACATAGAAATCTGACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024664
VALIDATED
PPCS MISSION shRNA shRNA Plasmid DNA
phosphopantothenoylcysteine synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024664.1-828s1c1
Sequence:CCGGCGGAAACCAAGTTATTGCTATCTCGAGATAGCAATAACTTGGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024664.1-734s1c1
Sequence:CCGGGCTCGGAAGGCTTTGGAAATTCTCGAGAATTTCCAAAGCCTTCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024664.2-1268s21c1
Sequence:CCGGGCCTGAATGTCAGCCATCTTTCTCGAGAAAGATGGCTGACATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024664.1-1210s1c1
Sequence:CCGGGCCTGAATGTCAGCCATCTTTCTCGAGAAAGATGGCTGACATTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024664.2-602s21c1
Sequence:CCGGGCTGTGTCAGATTTCTATGTTCTCGAGAACATAGAAATCTGACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024664.2-928s21c1
Sequence:CCGGCGTAGAGATAGAAGAGAAGATCTCGAGATCTTCTCTTCTATCTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024664.1-653s1c1
Sequence:CCGGCCTTTGGTTAAAGATTGGGCTCTCGAGAGCCCAATCTTTAACCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024664.1-870s1c1
Sequence:CCGGCGTAGAGATAGAAGAGAAGATCTCGAGATCTTCTCTTCTATCTCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024664.1-545s1c1
Sequence:CCGGGCTGTGTCAGATTTCTATGTTCTCGAGAACATAGAAATCTGACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024664
VALIDATED
PPCS MISSION shRNA Lentiviral Transduction Particles
phosphopantothenoylcysteine synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024664.1-828s1c1
Sequence:CCGGCGGAAACCAAGTTATTGCTATCTCGAGATAGCAATAACTTGGTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024664.1-734s1c1
Sequence:CCGGGCTCGGAAGGCTTTGGAAATTCTCGAGAATTTCCAAAGCCTTCCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024664.2-1268s21c1
Sequence:CCGGGCCTGAATGTCAGCCATCTTTCTCGAGAAAGATGGCTGACATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024664.1-1210s1c1
Sequence:CCGGGCCTGAATGTCAGCCATCTTTCTCGAGAAAGATGGCTGACATTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024664.2-602s21c1
Sequence:CCGGGCTGTGTCAGATTTCTATGTTCTCGAGAACATAGAAATCTGACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024664.2-928s21c1
Sequence:CCGGCGTAGAGATAGAAGAGAAGATCTCGAGATCTTCTCTTCTATCTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024664.1-653s1c1
Sequence:CCGGCCTTTGGTTAAAGATTGGGCTCTCGAGAGCCCAATCTTTAACCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024664.1-870s1c1
Sequence:CCGGCGTAGAGATAGAAGAGAAGATCTCGAGATCTTCTCTTCTATCTCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024664.1-545s1c1
Sequence:CCGGGCTGTGTCAGATTTCTATGTTCTCGAGAACATAGAAATCTGACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026494
VALIDATED
PPCS MISSION shRNA Bacterial Glycerol Stock
phosphopantothenoylcysteine synthetase
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-935s21c1
Sequence:CCGGGTGATAGAAGAGAAGATAGTACTCGAGTACTATCTTCTCTTCTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-837s21c1
Sequence:CCGGCCAACATCCTGGAGTCAATAACTCGAGTTATTGACTCCAGGATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-1001s1c1
Sequence:CCGGCCAGAGCTCTTACCACTGATACTCGAGTATCAGTGGTAAGAGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-603s1c1
Sequence:CCGGCTCCGAAATGCCTGAACACAACTCGAGTTGTGTTCAGGCATTTCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026494.3-1030s21c1
Sequence:CCGGCCAGAGCTCTTACCACTGATACTCGAGTATCAGTGGTAAGAGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-766s21c1
Sequence:CCGGGACAGACCCGGACATCATAATCTCGAGATTATGATGTCCGGGTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-512s21c1
Sequence:CCGGTTTACCACTTTGGCGGATTATCTCGAGATAATCCGCCAAAGTGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-907s1c1
Sequence:CCGGGTGATAGAAGAGAAGATAGTACTCGAGTACTATCTTCTCTTCTATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-833s1c1
Sequence:CCGGCCTTTGTGATTATTGTAACCACTCGAGTGGTTACAATAATCACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-575s1c1
Sequence:CCGGCGGCAGTGTCAGATTTCTATACTCGAGTATAGAAATCTGACACTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-766s1c1
Sequence:CCGGGCTCGGAATGCTTTGGAAGTTCTCGAGAACTTCCAAAGCATTCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-533s1c1
Sequence:CCGGCTCTCAGTCCATTAGGCTCTTCTCGAGAAGAGCCTAATGGACTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026494.1-1042s1c1
Sequence:CCGGGTTAAGGATCAACACAGTGAACTCGAGTTCACTGTGTTGATCCTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026494
VALIDATED
PPCS MISSION shRNA shRNA Plasmid DNA
phosphopantothenoylcysteine synthetase
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-935s21c1
Sequence:CCGGGTGATAGAAGAGAAGATAGTACTCGAGTACTATCTTCTCTTCTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-837s21c1
Sequence:CCGGCCAACATCCTGGAGTCAATAACTCGAGTTATTGACTCCAGGATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-1001s1c1
Sequence:CCGGCCAGAGCTCTTACCACTGATACTCGAGTATCAGTGGTAAGAGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-603s1c1
Sequence:CCGGCTCCGAAATGCCTGAACACAACTCGAGTTGTGTTCAGGCATTTCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026494.3-1030s21c1
Sequence:CCGGCCAGAGCTCTTACCACTGATACTCGAGTATCAGTGGTAAGAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-766s21c1
Sequence:CCGGGACAGACCCGGACATCATAATCTCGAGATTATGATGTCCGGGTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-512s21c1
Sequence:CCGGTTTACCACTTTGGCGGATTATCTCGAGATAATCCGCCAAAGTGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-907s1c1
Sequence:CCGGGTGATAGAAGAGAAGATAGTACTCGAGTACTATCTTCTCTTCTATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-833s1c1
Sequence:CCGGCCTTTGTGATTATTGTAACCACTCGAGTGGTTACAATAATCACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-575s1c1
Sequence:CCGGCGGCAGTGTCAGATTTCTATACTCGAGTATAGAAATCTGACACTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-766s1c1
Sequence:CCGGGCTCGGAATGCTTTGGAAGTTCTCGAGAACTTCCAAAGCATTCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-533s1c1
Sequence:CCGGCTCTCAGTCCATTAGGCTCTTCTCGAGAAGAGCCTAATGGACTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026494.1-1042s1c1
Sequence:CCGGGTTAAGGATCAACACAGTGAACTCGAGTTCACTGTGTTGATCCTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026494
VALIDATED
PPCS MISSION shRNA Lentiviral Transduction Particles
phosphopantothenoylcysteine synthetase
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-935s21c1
Sequence:CCGGGTGATAGAAGAGAAGATAGTACTCGAGTACTATCTTCTCTTCTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-837s21c1
Sequence:CCGGCCAACATCCTGGAGTCAATAACTCGAGTTATTGACTCCAGGATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-1001s1c1
Sequence:CCGGCCAGAGCTCTTACCACTGATACTCGAGTATCAGTGGTAAGAGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-603s1c1
Sequence:CCGGCTCCGAAATGCCTGAACACAACTCGAGTTGTGTTCAGGCATTTCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026494.3-1030s21c1
Sequence:CCGGCCAGAGCTCTTACCACTGATACTCGAGTATCAGTGGTAAGAGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-766s21c1
Sequence:CCGGGACAGACCCGGACATCATAATCTCGAGATTATGATGTCCGGGTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026494.3-512s21c1
Sequence:CCGGTTTACCACTTTGGCGGATTATCTCGAGATAATCCGCCAAAGTGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-907s1c1
Sequence:CCGGGTGATAGAAGAGAAGATAGTACTCGAGTACTATCTTCTCTTCTATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-833s1c1
Sequence:CCGGCCTTTGTGATTATTGTAACCACTCGAGTGGTTACAATAATCACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-575s1c1
Sequence:CCGGCGGCAGTGTCAGATTTCTATACTCGAGTATAGAAATCTGACACTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026494.1-766s1c1
Sequence:CCGGGCTCGGAATGCTTTGGAAGTTCTCGAGAACTTCCAAAGCATTCCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026494.1-533s1c1
Sequence:CCGGCTCTCAGTCCATTAGGCTCTTCTCGAGAAGAGCCTAATGGACTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026494.1-1042s1c1
Sequence:CCGGGTTAAGGATCAACACAGTGAACTCGAGTTCACTGTGTTGATCCTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)