EMAIL THIS PAGE TO A FRIEND

PPDPF

pancreatic progenitor cell differentiation and proliferation factor

37 Gene Product Result for
Synonyms: C20orf149 dJ697K14.9 exdpf
UniProtKB ID: Q9H3Y8, E1P5J2, Q4VXP1, Q9H3Y7
Gene ID:
Mouse(66496) pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)RIKEN cDNA 2700038C09 gene
Rat(296470) pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)
chicken(419245) pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)
domestic cat(101100553) pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)
cow(506990) pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)
sheep(101118376) pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)
naked mole-rat(101721778) pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024299 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024299 Rosetta Predictions human pricing
NM_001009316 Rosetta Predictions rat pricing
NM_025598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231121 predicted 287
2 SASI_Hs01_00231122 predicted 290
3 SASI_Hs01_00231123 predicted 219
4 SASI_Hs01_00231124 predicted 202
5 SASI_Hs01_00231125 predicted 214
6 SASI_Hs01_00231126 predicted 198
7 SASI_Hs01_00231127 predicted 289
8 SASI_Hs01_00231128 predicted 189
9 SASI_Hs01_00231129 predicted 472
10 SASI_Hs01_00231130 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078060 predicted 265
2 SASI_Rn01_00078061 predicted 234
3 SASI_Rn01_00078062 predicted 386
4 SASI_Rn01_00078064 predicted 262
5 SASI_Rn01_00078065 predicted 415
6 SASI_Rn01_00078066 predicted 300
7 SASI_Rn01_00078067 predicted 266
8 SASI_Rn01_00078068 predicted 312
9 SASI_Rn01_00078069 predicted 287
10 SASI_Rn02_00199513 predicted 387
11 SASI_Rn01_00078063 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114291 predicted 396
2 SASI_Mm01_00114293 predicted 575
3 SASI_Mm01_00114294 predicted 427
4 SASI_Mm02_00328603 predicted 506
5 SASI_Mm01_00114295 predicted 387
6 SASI_Mm01_00114296 predicted 267
7 SASI_Mm01_00114297 predicted 576
8 SASI_Mm01_00114298 predicted 547
9 SASI_Mm01_00114299 predicted 328
10 SASI_Mm01_00114300 predicted 366
11 SASI_Mm01_00114292 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025598
VALIDATED
PPDPF MISSION shRNA Bacterial Glycerol Stock
pancreatic progenitor cell differentiation and proliferation factor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-427s21c1
Sequence:CCGGGAAATCCACACTCCCGTTCATCTCGAGATGAACGGGAGTGTGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-276s21c1
Sequence:CCGGTGGCTACCCATGACTACTATCCTCGAGGATAGTAGTCATGGGTAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-428s1c1
Sequence:CCGGGAAATCCACACTCCCGTTCATCTCGAGATGAACGGGAGTGTGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-521s1c1
Sequence:CCGGCCTGACTCCTGAAACCATGAACTCGAGTTCATGGTTTCAGGAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-580s21c1
Sequence:CCGGGGACCTTTCCTGACCTATCAGCTCGAGCTGATAGGTCAGGAAAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-514s21c1
Sequence:CCGGCTGTGGCCTGACTCCTGAAACCTCGAGGTTTCAGGAGTCAGGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-441s1c1
Sequence:CCGGCCGTTCATGACTACAGTGTTGCTCGAGCAACACTGTAGTCATGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025598
VALIDATED
PPDPF MISSION shRNA shRNA Plasmid DNA
pancreatic progenitor cell differentiation and proliferation factor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-427s21c1
Sequence:CCGGGAAATCCACACTCCCGTTCATCTCGAGATGAACGGGAGTGTGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-276s21c1
Sequence:CCGGTGGCTACCCATGACTACTATCCTCGAGGATAGTAGTCATGGGTAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-428s1c1
Sequence:CCGGGAAATCCACACTCCCGTTCATCTCGAGATGAACGGGAGTGTGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-521s1c1
Sequence:CCGGCCTGACTCCTGAAACCATGAACTCGAGTTCATGGTTTCAGGAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-580s21c1
Sequence:CCGGGGACCTTTCCTGACCTATCAGCTCGAGCTGATAGGTCAGGAAAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-514s21c1
Sequence:CCGGCTGTGGCCTGACTCCTGAAACCTCGAGGTTTCAGGAGTCAGGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-441s1c1
Sequence:CCGGCCGTTCATGACTACAGTGTTGCTCGAGCAACACTGTAGTCATGAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025598
VALIDATED
PPDPF MISSION shRNA Lentiviral Transduction Particles
pancreatic progenitor cell differentiation and proliferation factor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-427s21c1
Sequence:CCGGGAAATCCACACTCCCGTTCATCTCGAGATGAACGGGAGTGTGGATTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-276s21c1
Sequence:CCGGTGGCTACCCATGACTACTATCCTCGAGGATAGTAGTCATGGGTAGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000189896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-428s1c1
Sequence:CCGGGAAATCCACACTCCCGTTCATCTCGAGATGAACGGGAGTGTGGATTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000202033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-521s1c1
Sequence:CCGGCCTGACTCCTGAAACCATGAACTCGAGTTCATGGTTTCAGGAGTCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-580s21c1
Sequence:CCGGGGACCTTTCCTGACCTATCAGCTCGAGCTGATAGGTCAGGAAAGGTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025598.2-514s21c1
Sequence:CCGGCTGTGGCCTGACTCCTGAAACCTCGAGGTTTCAGGAGTCAGGCCACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000202143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025598.1-441s1c1
Sequence:CCGGCCGTTCATGACTACAGTGTTGCTCGAGCAACACTGTAGTCATGAACGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024299
PPDPF MISSION shRNA Bacterial Glycerol Stock
pancreatic progenitor cell differentiation and proliferation factor
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-480s21c1
Sequence:CCGGTCCTGACCTGAGCGGTTACCACTCGAGTGGTAACCGCTCAGGTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024299.2-622s21c1
Sequence:CCGGGCAAGCAGACCTTCGCATCAACTCGAGTTGATGCGAAGGTCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-323s21c1
Sequence:CCGGGAAGTCCACCCTCCCGTTCATCTCGAGATGAACGGGAGGGTGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-202s21c1
Sequence:CCGGTGGGTTCCACTTCCAGCAACACTCGAGTGTTGCTGGAAGTGGAACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024299
PPDPF MISSION shRNA shRNA Plasmid DNA
pancreatic progenitor cell differentiation and proliferation factor
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-480s21c1
Sequence:CCGGTCCTGACCTGAGCGGTTACCACTCGAGTGGTAACCGCTCAGGTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024299.2-622s21c1
Sequence:CCGGGCAAGCAGACCTTCGCATCAACTCGAGTTGATGCGAAGGTCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-323s21c1
Sequence:CCGGGAAGTCCACCCTCCCGTTCATCTCGAGATGAACGGGAGGGTGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-202s21c1
Sequence:CCGGTGGGTTCCACTTCCAGCAACACTCGAGTGTTGCTGGAAGTGGAACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024299
PPDPF MISSION shRNA Lentiviral Transduction Particles
pancreatic progenitor cell differentiation and proliferation factor
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-480s21c1
Sequence:CCGGTCCTGACCTGAGCGGTTACCACTCGAGTGGTAACCGCTCAGGTCAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000282752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024299.2-622s21c1
Sequence:CCGGGCAAGCAGACCTTCGCATCAACTCGAGTTGATGCGAAGGTCTGCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000263663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-323s21c1
Sequence:CCGGGAAGTCCACCCTCCCGTTCATCTCGAGATGAACGGGAGGGTGGACTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000263664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024299.2-202s21c1
Sequence:CCGGTGGGTTCCACTTCCAGCAACACTCGAGTGTTGCTGGAAGTGGAACCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???