EMAIL THIS PAGE TO A FRIEND

PPEF1

protein phosphatase, EF-hand calcium binding domain 1

123 Gene Product Result for
Synonyms: PP7 PPEF PPP7C PPP7CA
UniProtKB ID: O14829, A6NHP4, A8K348, O15253, Q9NU21, Q9UJH0
Gene ID:
Human(5475) Summary: This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein has been suggested to play a role in specific sensory neuron function and/or development. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. Several alternatively spliced transcript variants, each encoding a distinct isoform, have been described. [provided by RefSeq, Jul 2008]
Mouse(237178) protein phosphatase with EF hand calcium-binding domain 1
Rat(317498) protein phosphatase, EF-hand calcium binding domain 1
Zebrafish(559132) protein phosphatase, EF-hand calcium binding domain 1
dog(100688966) protein phosphatase, EF-hand calcium binding domain 1
domestic cat(101089080) protein phosphatase, EF-hand calcium binding domain 1
chicken(427999) protein phosphatase, EF-hand calcium binding domain 1
naked mole-rat(101713218) protein phosphatase, EF-hand calcium binding domain 1
domestic guinea pig(100719586) protein phosphatase, EF-hand calcium binding domain 1
cow(504618) protein phosphatase, EF-hand calcium binding domain 1
sheep(101104376) protein phosphatase, EF-hand calcium binding domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_142281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_142281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_142281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006240 Rosetta Predictions human pricing
NM_152223 Rosetta Predictions human pricing
NM_152224 Rosetta Predictions human pricing
NM_152225 Rosetta Predictions human pricing
NM_152226 Rosetta Predictions human pricing
NM_001034935 Rosetta Predictions rat pricing
NM_011147 Rosetta Predictions mouse pricing
XM_142281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341161 predicted 867
2 SASI_Hs02_00341162 predicted 762
3 SASI_Hs01_00220567 predicted 1199
4 SASI_Hs01_00220568 predicted 1114
5 SASI_Hs02_00341163 predicted 934
6 SASI_Hs01_00220570 predicted 2425
7 SASI_Hs01_00220572 predicted 2377
8 SASI_Hs02_00341164 predicted 2206
9 SASI_Hs01_00220574 predicted 2394
10 SASI_Hs02_00341165 predicted 619
11 SASI_Hs01_00220569 predicted 2347
12 SASI_Hs01_00220571 predicted 2311
13 SASI_Hs01_00220573 predicted 2499
14 SASI_Hs01_00220575 predicted 2339
15 SASI_Hs01_00220576 predicted 2377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170243 predicted 1044
2 SASI_Hs01_00170244 predicted 961
3 SASI_Hs01_00170245 predicted 2184
4 SASI_Hs01_00170246 predicted 2271
5 SASI_Hs01_00170247 predicted 2147
6 SASI_Hs01_00170248 predicted 2229
7 SASI_Hs01_00170249 predicted 2332
8 SASI_Hs01_00170250 predicted 2238
9 SASI_Hs01_00170251 predicted 2175
10 SASI_Hs01_00170252 predicted 2224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365711 predicted 866
2 SASI_Hs02_00365712 predicted 763
3 SASI_Hs01_00146932 predicted 1200
4 SASI_Hs01_00146933 predicted 1117
5 SASI_Hs02_00365713 predicted 935
6 SASI_Hs01_00146935 predicted 2343
7 SASI_Hs01_00146937 predicted 2294
8 SASI_Hs01_00146938 predicted 2402
9 SASI_Hs01_00146939 predicted 2306
10 SASI_Hs02_00365714 predicted 621
11 SASI_Hs01_00146934 predicted 2262
12 SASI_Hs01_00146936 predicted 2224
13 SASI_Hs01_00146940 predicted 2259
14 SASI_Hs01_00146941 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039665 predicted 1200
2 SASI_Hs01_00039666 predicted 1115
3 SASI_Hs01_00039667 predicted 2020
4 SASI_Hs01_00039668 predicted 2099
5 SASI_Hs01_00039669 predicted 1981
6 SASI_Hs01_00039670 predicted 2060
7 SASI_Hs01_00039671 predicted 2100
8 SASI_Hs01_00039672 predicted 2070
9 SASI_Hs01_00039673 predicted 1204
10 SASI_Hs01_00039674 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365715 predicted 867
2 SASI_Hs02_00365716 predicted 761
3 SASI_Hs01_00171019 predicted 1202
4 SASI_Hs01_00171020 predicted 1116
5 SASI_Hs02_00365717 predicted 936
6 SASI_Hs01_00171022 predicted 2239
7 SASI_Hs01_00171024 predicted 2199
8 SASI_Hs01_00171025 predicted 2300
9 SASI_Hs01_00171027 predicted 2213
10 SASI_Hs02_00365718 predicted 618
11 SASI_Hs01_00171021 predicted 2158
12 SASI_Hs01_00171023 predicted 2130
13 SASI_Hs01_00171026 predicted 2031
14 SASI_Hs01_00171028 predicted 2151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066668 predicted 356
2 SASI_Rn01_00066669 predicted 1407
3 SASI_Rn01_00066670 predicted 1771
4 SASI_Rn01_00066671 predicted 1423
5 SASI_Rn01_00066672 predicted 726
6 SASI_Rn01_00066673 predicted 1084
7 SASI_Rn01_00066674 predicted 543
8 SASI_Rn01_00066675 predicted 1978
9 SASI_Rn01_00066677 predicted 956
10 SASI_Rn02_00204119 predicted 472
11 SASI_Rn01_00066676 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319995 predicted 969
2 SASI_Mm02_00319996 predicted 757
3 SASI_Mm02_00319997 predicted 1695
4 SASI_Mm02_00319998 predicted 1105
5 SASI_Mm02_00319999 predicted 1747
6 SASI_Mm02_00320000 predicted 961
7 SASI_Mm02_00320001 predicted 472
8 SASI_Mm02_00320002 predicted 1671
9 SASI_Mm02_00320003 predicted 345
10 SASI_Mm02_00320004 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_142281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248577 predicted 349
2 SASI_Mm01_00248578 predicted 503
3 SASI_Mm01_00248579 predicted 439
4 SASI_Mm01_00248580 predicted 467
5 SASI_Mm01_00248581 predicted 356
6 SASI_Mm01_00248582 predicted 223
7 SASI_Mm01_00248583 predicted 414
8 SASI_Mm01_00248584 predicted 279
9 SASI_Mm01_00248585 predicted 522
10 SASI_Mm01_00248586 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_142281
PPEF1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, EF-hand calcium binding domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1660s1c1
Sequence:CCGGGCTTTCAAGATACTAAAGGAACTCGAGTTCCTTTAGTATCTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1229s1c1
Sequence:CCGGCGTCAAATTATGTTGAACCAACTCGAGTTGGTTCAACATAATTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1214s1c1
Sequence:CCGGAGAGAAATAAATCAGCGTCAACTCGAGTTGACGCTGATTTATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-708s1c1
Sequence:CCGGGCCGAATTTCTCTCATGTAAACTCGAGTTTACATGAGAGAAATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-2041s1c1
Sequence:CCGGGCTCATTACAAAGCTCATATACTCGAGTATATGAGCTTTGTAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_142281
PPEF1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase, EF-hand calcium binding domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1660s1c1
Sequence:CCGGGCTTTCAAGATACTAAAGGAACTCGAGTTCCTTTAGTATCTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1229s1c1
Sequence:CCGGCGTCAAATTATGTTGAACCAACTCGAGTTGGTTCAACATAATTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1214s1c1
Sequence:CCGGAGAGAAATAAATCAGCGTCAACTCGAGTTGACGCTGATTTATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-708s1c1
Sequence:CCGGGCCGAATTTCTCTCATGTAAACTCGAGTTTACATGAGAGAAATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-2041s1c1
Sequence:CCGGGCTCATTACAAAGCTCATATACTCGAGTATATGAGCTTTGTAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_142281
PPEF1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, EF-hand calcium binding domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1660s1c1
Sequence:CCGGGCTTTCAAGATACTAAAGGAACTCGAGTTCCTTTAGTATCTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1229s1c1
Sequence:CCGGCGTCAAATTATGTTGAACCAACTCGAGTTGGTTCAACATAATTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-1214s1c1
Sequence:CCGGAGAGAAATAAATCAGCGTCAACTCGAGTTGACGCTGATTTATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-708s1c1
Sequence:CCGGGCCGAATTTCTCTCATGTAAACTCGAGTTTACATGAGAGAAATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142281.5-2041s1c1
Sequence:CCGGGCTCATTACAAAGCTCATATACTCGAGTATATGAGCTTTGTAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006240
PPEF1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, EF-hand calcium binding domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-812s1c1
Sequence:CCGGCGGCTACAATTTCCTCTCACTCTCGAGAGTGAGAGGAAATTGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1506s1c1
Sequence:CCGGGATCTCCTACTGAACACTTAACTCGAGTTAAGTGTTCAGTAGGAGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1080s1c1
Sequence:CCGGGTGACTTTGTAGATCGAGGAACTCGAGTTCCTCGATCTACAAAGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1781s1c1
Sequence:CCGGCGAGGAGCTTACATCAAACTACTCGAGTAGTTTGATGTAAGCTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006240.x-2480s1c1
Sequence:CCGGGCTAGGCCCAAATCACAAGTACTCGAGTACTTGTGATTTGGGCCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-2314s21c1
Sequence:CCGGCAATAAGCTTGCCAACATAATCTCGAGATTATGTTGGCAAGCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-824s21c1
Sequence:CCGGCCTCTCACTTGTACGGATATTCTCGAGAATATCCGTACAAGTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-785s21c1
Sequence:CCGGGATGTCCCAGACTCCTATAATCTCGAGATTATAGGAGTCTGGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-876s21c1
Sequence:CCGGAGATACTTCATGCCCATTATGCTCGAGCATAATGGGCATGAAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006240
PPEF1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase, EF-hand calcium binding domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-812s1c1
Sequence:CCGGCGGCTACAATTTCCTCTCACTCTCGAGAGTGAGAGGAAATTGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1506s1c1
Sequence:CCGGGATCTCCTACTGAACACTTAACTCGAGTTAAGTGTTCAGTAGGAGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1080s1c1
Sequence:CCGGGTGACTTTGTAGATCGAGGAACTCGAGTTCCTCGATCTACAAAGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1781s1c1
Sequence:CCGGCGAGGAGCTTACATCAAACTACTCGAGTAGTTTGATGTAAGCTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006240.x-2480s1c1
Sequence:CCGGGCTAGGCCCAAATCACAAGTACTCGAGTACTTGTGATTTGGGCCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-2314s21c1
Sequence:CCGGCAATAAGCTTGCCAACATAATCTCGAGATTATGTTGGCAAGCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-824s21c1
Sequence:CCGGCCTCTCACTTGTACGGATATTCTCGAGAATATCCGTACAAGTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-785s21c1
Sequence:CCGGGATGTCCCAGACTCCTATAATCTCGAGATTATAGGAGTCTGGGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-876s21c1
Sequence:CCGGAGATACTTCATGCCCATTATGCTCGAGCATAATGGGCATGAAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006240
PPEF1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, EF-hand calcium binding domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-812s1c1
Sequence:CCGGCGGCTACAATTTCCTCTCACTCTCGAGAGTGAGAGGAAATTGTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1506s1c1
Sequence:CCGGGATCTCCTACTGAACACTTAACTCGAGTTAAGTGTTCAGTAGGAGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1080s1c1
Sequence:CCGGGTGACTTTGTAGATCGAGGAACTCGAGTTCCTCGATCTACAAAGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006240.x-1781s1c1
Sequence:CCGGCGAGGAGCTTACATCAAACTACTCGAGTAGTTTGATGTAAGCTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006240.x-2480s1c1
Sequence:CCGGGCTAGGCCCAAATCACAAGTACTCGAGTACTTGTGATTTGGGCCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-2314s21c1
Sequence:CCGGCAATAAGCTTGCCAACATAATCTCGAGATTATGTTGGCAAGCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-824s21c1
Sequence:CCGGCCTCTCACTTGTACGGATATTCTCGAGAATATCCGTACAAGTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-785s21c1
Sequence:CCGGGATGTCCCAGACTCCTATAATCTCGAGATTATAGGAGTCTGGGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006240.2-876s21c1
Sequence:CCGGAGATACTTCATGCCCATTATGCTCGAGCATAATGGGCATGAAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)