EMAIL THIS PAGE TO A FRIEND

PPEF2

protein phosphatase, EF-hand calcium binding domain 2

108 Gene Product Result for
Synonyms: PPP7CB
UniProtKB ID: O14830, O14831
Gene ID:
Human(5470) Summary: This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
Mouse(19023) protein phosphatase, EF hand calcium-binding domain 2
Rat(305246) protein phosphatase, EF hand calcium-binding domain 2
chicken(422640) protein phosphatase, EF-hand calcium binding domain 2
Horse(100050916) protein phosphatase, EF-hand calcium binding domain 2
domestic cat(101092108) protein phosphatase, EF-hand calcium binding domain 2
dog(487812) protein phosphatase, EF-hand calcium binding domain 2
cow(530344) protein phosphatase, EF-hand calcium binding domain 2
sheep(101107703) protein phosphatase, EF-hand calcium binding domain 2
domestic guinea pig(100714116) protein phosphatase, EF-hand calcium binding domain 2
Domestic Rabbit(100341368) protein phosphatase, EF-hand calcium binding domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006239 Rosetta Predictions human pricing
NM_152933 Rosetta Predictions human pricing
NM_152934 Rosetta Predictions human pricing
NM_001107210 Rosetta Predictions rat pricing
NM_011148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341156 predicted 548
2 SASI_Hs01_00158444 predicted 1080
3 SASI_Hs01_00158445 predicted 2338
4 SASI_Hs01_00158446 predicted 2482
5 SASI_Hs02_00341157 predicted 886
6 SASI_Hs01_00158448 predicted 2663
7 SASI_Hs02_00341158 predicted 2059
8 SASI_Hs01_00158450 predicted 1769
9 SASI_Hs02_00341159 predicted 1000
10 SASI_Hs02_00341160 predicted 2195
11 SASI_Hs01_00158447 predicted 2576
12 SASI_Hs01_00158449 predicted 1841
13 SASI_Hs01_00158451 predicted 2636
14 SASI_Hs01_00158452 predicted 1119
15 SASI_Hs01_00158453 predicted 2461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044804 predicted 1082
2 SASI_Hs01_00044805 predicted 1854
3 SASI_Hs01_00044806 predicted 2511
4 SASI_Hs01_00044807 predicted 1840
5 SASI_Hs01_00044808 predicted 1767
6 SASI_Hs01_00044809 predicted 1204
7 SASI_Hs01_00044810 predicted 2581
8 SASI_Hs01_00044811 predicted 1289
9 SASI_Hs01_00044812 predicted 2604
10 SASI_Hs01_00044813 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202817 predicted 1091
2 SASI_Hs01_00202818 predicted 1089
3 SASI_Hs01_00202819 predicted 1008
4 SASI_Hs01_00202820 predicted 486
5 SASI_Hs01_00202821 predicted 1093
6 SASI_Hs01_00202822 predicted 1207
7 SASI_Hs01_00202823 predicted 427
8 SASI_Hs01_00202824 predicted 999
9 SASI_Hs01_00202825 predicted 536
10 SASI_Hs01_00202826 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226595 predicted 694
2 SASI_Rn02_00226596 predicted 900
3 SASI_Rn02_00226597 predicted 2261
4 SASI_Rn02_00226598 predicted 1720
5 SASI_Rn02_00226599 predicted 2137
6 SASI_Rn02_00226600 predicted 1053
7 SASI_Rn02_00226601 predicted 1773
8 SASI_Rn02_00226602 predicted 1682
9 SASI_Rn02_00226603 predicted 400
10 SASI_Rn02_00226604 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059240 predicted 898
2 SASI_Mm01_00059241 predicted 238
3 SASI_Mm01_00059242 predicted 1490
4 SASI_Mm02_00320005 predicted 400
5 SASI_Mm01_00059243 predicted 762
6 SASI_Mm01_00059247 predicted 1852
7 SASI_Mm02_00320006 predicted 1993
8 SASI_Mm01_00059248 predicted 1601
9 SASI_Mm02_00320007 predicted 427
10 SASI_Mm02_00320008 predicted 1642
11 SASI_Mm01_00059244 predicted 2014
12 SASI_Mm01_00059245 predicted 2599
13 SASI_Mm01_00059246 predicted 434
14 SASI_Mm01_00059249 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006239
PPEF2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, EF-hand calcium binding domain 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006239.2-600s21c1
Sequence:CCGGGGACTTCCTGACCCGCATATTCTCGAGAATATGCGGGTCAGGAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006239.2-1850s21c1
Sequence:CCGGGTCACAACCGCAAGGTATTAACTCGAGTTAATACCTTGCGGTTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-1247s1c1
Sequence:CCGGACATAACTGATCTGGAGCTTTCTCGAGAAAGCTCCAGATCAGTTATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-2318s1c1
Sequence:CCGGGATCCAACCTAGAGACCATTTCTCGAGAAATGGTCTCTAGGTTGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-2272s1c1
Sequence:CCGGCGCGAGAACATACAATCAAGTCTCGAGACTTGATTGTATGTTCTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006239.x-2822s1c1
Sequence:CCGGCCCACCTCACAATCTTCACAACTCGAGTTGTGAAGATTGTGAGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-1114s1c1
Sequence:CCGGACCAAGGAAGTGATGAATAAACTCGAGTTTATTCATCACTTCCTTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006239
PPEF2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase, EF-hand calcium binding domain 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006239.2-600s21c1
Sequence:CCGGGGACTTCCTGACCCGCATATTCTCGAGAATATGCGGGTCAGGAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006239.2-1850s21c1
Sequence:CCGGGTCACAACCGCAAGGTATTAACTCGAGTTAATACCTTGCGGTTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-1247s1c1
Sequence:CCGGACATAACTGATCTGGAGCTTTCTCGAGAAAGCTCCAGATCAGTTATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-2318s1c1
Sequence:CCGGGATCCAACCTAGAGACCATTTCTCGAGAAATGGTCTCTAGGTTGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-2272s1c1
Sequence:CCGGCGCGAGAACATACAATCAAGTCTCGAGACTTGATTGTATGTTCTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006239.x-2822s1c1
Sequence:CCGGCCCACCTCACAATCTTCACAACTCGAGTTGTGAAGATTGTGAGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-1114s1c1
Sequence:CCGGACCAAGGAAGTGATGAATAAACTCGAGTTTATTCATCACTTCCTTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006239
PPEF2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, EF-hand calcium binding domain 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006239.2-600s21c1
Sequence:CCGGGGACTTCCTGACCCGCATATTCTCGAGAATATGCGGGTCAGGAAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006239.2-1850s21c1
Sequence:CCGGGTCACAACCGCAAGGTATTAACTCGAGTTAATACCTTGCGGTTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-1247s1c1
Sequence:CCGGACATAACTGATCTGGAGCTTTCTCGAGAAAGCTCCAGATCAGTTATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-2318s1c1
Sequence:CCGGGATCCAACCTAGAGACCATTTCTCGAGAAATGGTCTCTAGGTTGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-2272s1c1
Sequence:CCGGCGCGAGAACATACAATCAAGTCTCGAGACTTGATTGTATGTTCTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006239.x-2822s1c1
Sequence:CCGGCCCACCTCACAATCTTCACAACTCGAGTTGTGAAGATTGTGAGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006239.x-1114s1c1
Sequence:CCGGACCAAGGAAGTGATGAATAAACTCGAGTTTATTCATCACTTCCTTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011148
PPEF2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, EF-hand calcium binding domain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011148.2-2667s1c1
Sequence:CCGGGCCACCACAAAGCATTCAAATCTCGAGATTTGAATGCTTTGTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-2031s1c1
Sequence:CCGGCGGACCTGCTTGTTGAGTTTACTCGAGTAAACTCAACAAGCAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-1906s1c1
Sequence:CCGGGACTCCACATATCGTGCAGTACTCGAGTACTGCACGATATGTGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-1036s1c1
Sequence:CCGGCCATCTAGTGAACCTACGATACTCGAGTATCGTAGGTTCACTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-341s1c1
Sequence:CCGGGCGTTTCAGAACGCTGAGAAACTCGAGTTTCTCAGCGTTCTGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011148
PPEF2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase, EF-hand calcium binding domain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011148.2-2667s1c1
Sequence:CCGGGCCACCACAAAGCATTCAAATCTCGAGATTTGAATGCTTTGTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-2031s1c1
Sequence:CCGGCGGACCTGCTTGTTGAGTTTACTCGAGTAAACTCAACAAGCAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-1906s1c1
Sequence:CCGGGACTCCACATATCGTGCAGTACTCGAGTACTGCACGATATGTGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-1036s1c1
Sequence:CCGGCCATCTAGTGAACCTACGATACTCGAGTATCGTAGGTTCACTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-341s1c1
Sequence:CCGGGCGTTTCAGAACGCTGAGAAACTCGAGTTTCTCAGCGTTCTGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011148
PPEF2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, EF-hand calcium binding domain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011148.2-2667s1c1
Sequence:CCGGGCCACCACAAAGCATTCAAATCTCGAGATTTGAATGCTTTGTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-2031s1c1
Sequence:CCGGCGGACCTGCTTGTTGAGTTTACTCGAGTAAACTCAACAAGCAGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-1906s1c1
Sequence:CCGGGACTCCACATATCGTGCAGTACTCGAGTACTGCACGATATGTGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-1036s1c1
Sequence:CCGGCCATCTAGTGAACCTACGATACTCGAGTATCGTAGGTTCACTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011148.2-341s1c1
Sequence:CCGGGCGTTTCAGAACGCTGAGAAACTCGAGTTTCTCAGCGTTCTGAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)