EMAIL THIS PAGE TO A FRIEND

PPFIA1

protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1

170 Gene Product Result for
Synonyms: LIP.1 LIP1 LIPRIN
UniProtKB ID: Q13136, A6NLE3, Q13135, Q14567, Q8N4I2
Gene ID:
Human(8500) Summary: The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(233977) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Rat(293645) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Domestic Rabbit(100338538) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
naked mole-rat(101707111) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
domestic guinea pig(100730910) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
cow(100139635) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
sheep(101117290) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
chicken(423147) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Horse(100147331) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Horse(100147641) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
domestic cat(101088110) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
dog(475999) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU149491 MISSION® esiRNA targeting mouse Ppfia1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003626 Rosetta Predictions human pricing
NM_177423 Rosetta Predictions human pricing
NM_001106320 Rosetta Predictions rat pricing
NM_001033319 Rosetta Predictions mouse pricing
XM_133979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243165 predicted 1287
2 SASI_Hs02_00335974 predicted 705
3 SASI_Hs01_00243166 predicted 1506
4 SASI_Hs01_00243167 predicted 549
5 SASI_Hs01_00243169 predicted 731
6 SASI_Hs01_00243170 predicted 1738
7 SASI_Hs01_00243171 predicted 1940
8 SASI_Hs01_00243172 predicted 395
9 SASI_Hs01_00243174 predicted 2492
10 SASI_Hs02_00335975 predicted 1972
11 SASI_Hs01_00243168 predicted 1986
12 SASI_Hs01_00243173 predicted 3384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167376 predicted 1295
2 SASI_Hs02_00369322 predicted 707
3 SASI_Hs01_00167377 predicted 1513
4 SASI_Hs01_00167378 predicted 545
5 SASI_Hs01_00167380 predicted 737
6 SASI_Hs01_00167382 predicted 1731
7 SASI_Hs01_00167383 predicted 1938
8 SASI_Hs01_00167384 predicted 398
9 SASI_Hs01_00167385 predicted 2486
10 SASI_Hs02_00369323 predicted 1970
11 SASI_Hs01_00167379 predicted 1982
12 SASI_Hs01_00167381 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217808 predicted 3622
2 SASI_Rn02_00217809 predicted 3187
3 SASI_Rn02_00217810 predicted 1309
4 SASI_Rn02_00217811 predicted 412
5 SASI_Rn02_00217812 predicted 2510
6 SASI_Rn02_00217813 predicted 1529
7 SASI_Rn02_00217814 predicted 3230
8 SASI_Rn02_00217815 predicted 1424
9 SASI_Rn02_00217816 predicted 879
10 SASI_Rn02_00217817 predicted 2703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288530 predicted 1593
2 SASI_Mm02_00288531 predicted 1472
3 SASI_Mm02_00288532 predicted 362
4 SASI_Mm02_00288533 predicted 3469
5 SASI_Mm02_00288534 predicted 3524
6 SASI_Mm02_00288535 predicted 3967
7 SASI_Mm02_00288536 predicted 889
8 SASI_Mm02_00288537 predicted 3475
9 SASI_Mm02_00288538 predicted 2268
10 SASI_Mm02_00288539 predicted 1919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233775 predicted 1642
2 SASI_Mm01_00233776 predicted 1518
3 SASI_Mm01_00233777 predicted 404
4 SASI_Mm01_00233778 predicted 3458
5 SASI_Mm01_00233779 predicted 3898
6 SASI_Mm01_00233780 predicted 1165
7 SASI_Mm01_00233781 predicted 947
8 SASI_Mm01_00233782 predicted 1097
9 SASI_Mm01_00233783 predicted 3404
10 SASI_Mm01_00233784 predicted 2314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003626
VALIDATED
PPFIA1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-764s1c1
Sequence:CCGGGTAGTTTGTTAGAAGAGGAATCTCGAGATTCCTCTTCTAACAAACTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003626.x-960s1c1
Sequence:CCGGGCTCCAAGAAATCATAAGTAACTCGAGTTACTTATGATTTCTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2389s21c1
Sequence:CCGGGATGACAAGACAACCATAAAGCTCGAGCTTTATGGTTGTCTTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003626.2-4063s21c1
Sequence:CCGGATGTATATCCAGGCTATAAATCTCGAGATTTATAGCCTGGATATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003626.2-907s21c1
Sequence:GTACCGGAGATCTTCTGATGGTTCTTTACTCGAGTAAAGAACCATCAGAAGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-1459s1c1
Sequence:CCGGGCACAGTTGGAGGAGAAGAATCTCGAGATTCTTCTCCTCCAACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003626.x-4944s1c1
Sequence:CCGGGCATATTAACAAGCCAGCAAACTCGAGTTTGCTGGCTTGTTAATATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-2170s1c1
Sequence:CCGGGAGGAGATTGAAAGTCGAGTTCTCGAGAACTCGACTTTCAATCTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2948s21c1
Sequence:GTACCGGCAGAGATCCAGCGTGAGATTGCTCGAGCAATCTCACGCTGGATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-4265s21c1
Sequence:GTACCGGAGCCATGTGCATTATCCTTTACTCGAGTAAAGGATAATGCACATGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2689s21c1
Sequence:GTACCGGGGTGTTTCCGAGACGGATAACCTCGAGGTTATCCGTCTCGGAAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2170s21c1
Sequence:CCGGGAGGAGATTGAAAGTCGAGTTCTCGAGAACTCGACTTTCAATCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-1893s21c1
Sequence:CCGGTGAGCCTTCCAAGGTACAAACCTCGAGGTTTGTACCTTGGAAGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-463s21c1
Sequence:CCGGGAGTTCGCAGCACTTACTAAACTCGAGTTTAGTAAGTGCTGCGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003626
VALIDATED
PPFIA1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-764s1c1
Sequence:CCGGGTAGTTTGTTAGAAGAGGAATCTCGAGATTCCTCTTCTAACAAACTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003626.x-960s1c1
Sequence:CCGGGCTCCAAGAAATCATAAGTAACTCGAGTTACTTATGATTTCTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2389s21c1
Sequence:CCGGGATGACAAGACAACCATAAAGCTCGAGCTTTATGGTTGTCTTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003626.2-4063s21c1
Sequence:CCGGATGTATATCCAGGCTATAAATCTCGAGATTTATAGCCTGGATATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003626.2-907s21c1
Sequence:GTACCGGAGATCTTCTGATGGTTCTTTACTCGAGTAAAGAACCATCAGAAGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-1459s1c1
Sequence:CCGGGCACAGTTGGAGGAGAAGAATCTCGAGATTCTTCTCCTCCAACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003626.x-4944s1c1
Sequence:CCGGGCATATTAACAAGCCAGCAAACTCGAGTTTGCTGGCTTGTTAATATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-2170s1c1
Sequence:CCGGGAGGAGATTGAAAGTCGAGTTCTCGAGAACTCGACTTTCAATCTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2948s21c1
Sequence:GTACCGGCAGAGATCCAGCGTGAGATTGCTCGAGCAATCTCACGCTGGATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-4265s21c1
Sequence:GTACCGGAGCCATGTGCATTATCCTTTACTCGAGTAAAGGATAATGCACATGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2689s21c1
Sequence:GTACCGGGGTGTTTCCGAGACGGATAACCTCGAGGTTATCCGTCTCGGAAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2170s21c1
Sequence:CCGGGAGGAGATTGAAAGTCGAGTTCTCGAGAACTCGACTTTCAATCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-1893s21c1
Sequence:CCGGTGAGCCTTCCAAGGTACAAACCTCGAGGTTTGTACCTTGGAAGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-463s21c1
Sequence:CCGGGAGTTCGCAGCACTTACTAAACTCGAGTTTAGTAAGTGCTGCGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003626
VALIDATED
PPFIA1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-764s1c1
Sequence:CCGGGTAGTTTGTTAGAAGAGGAATCTCGAGATTCCTCTTCTAACAAACTACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003626.x-960s1c1
Sequence:CCGGGCTCCAAGAAATCATAAGTAACTCGAGTTACTTATGATTTCTTGGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2389s21c1
Sequence:CCGGGATGACAAGACAACCATAAAGCTCGAGCTTTATGGTTGTCTTGTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003626.2-4063s21c1
Sequence:CCGGATGTATATCCAGGCTATAAATCTCGAGATTTATAGCCTGGATATACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003626.2-907s21c1
Sequence:GTACCGGAGATCTTCTGATGGTTCTTTACTCGAGTAAAGAACCATCAGAAGATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-1459s1c1
Sequence:CCGGGCACAGTTGGAGGAGAAGAATCTCGAGATTCTTCTCCTCCAACTGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003626.x-4944s1c1
Sequence:CCGGGCATATTAACAAGCCAGCAAACTCGAGTTTGCTGGCTTGTTAATATGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003626.x-2170s1c1
Sequence:CCGGGAGGAGATTGAAAGTCGAGTTCTCGAGAACTCGACTTTCAATCTCCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2948s21c1
Sequence:GTACCGGCAGAGATCCAGCGTGAGATTGCTCGAGCAATCTCACGCTGGATCTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-4265s21c1
Sequence:GTACCGGAGCCATGTGCATTATCCTTTACTCGAGTAAAGGATAATGCACATGGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2689s21c1
Sequence:GTACCGGGGTGTTTCCGAGACGGATAACCTCGAGGTTATCCGTCTCGGAAACACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-2170s21c1
Sequence:CCGGGAGGAGATTGAAAGTCGAGTTCTCGAGAACTCGACTTTCAATCTCCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-1893s21c1
Sequence:CCGGTGAGCCTTCCAAGGTACAAACCTCGAGGTTTGTACCTTGGAAGGCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003626.2-463s21c1
Sequence:CCGGGAGTTCGCAGCACTTACTAAACTCGAGTTTAGTAAGTGCTGCGAACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033319
VALIDATED
PPFIA1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033319.1-3142s21c1
Sequence:CCGGTGGGCTCAGACTCTAGCATATCTCGAGATATGCTAGAGTCTGAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-1657s21c1
Sequence:CCGGGACCAACTTGTCGTGACTATTCTCGAGAATAGTCACGACAAGTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-2385s21c1
Sequence:CCGGAGACGACAAGACGACGATAAACTCGAGTTTATCGTCGTCTTGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-3535s21c1
Sequence:CCGGTTGGACGAGACTTTCGATTTCCTCGAGGAAATCGAAAGTCTCGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-4127s21c1
Sequence:CCGGATGTATATCCAGGCTATAAATCTCGAGATTTATAGCCTGGATATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033319
VALIDATED
PPFIA1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033319.1-3142s21c1
Sequence:CCGGTGGGCTCAGACTCTAGCATATCTCGAGATATGCTAGAGTCTGAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-1657s21c1
Sequence:CCGGGACCAACTTGTCGTGACTATTCTCGAGAATAGTCACGACAAGTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-2385s21c1
Sequence:CCGGAGACGACAAGACGACGATAAACTCGAGTTTATCGTCGTCTTGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-3535s21c1
Sequence:CCGGTTGGACGAGACTTTCGATTTCCTCGAGGAAATCGAAAGTCTCGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-4127s21c1
Sequence:CCGGATGTATATCCAGGCTATAAATCTCGAGATTTATAGCCTGGATATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033319
VALIDATED
PPFIA1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033319.1-3142s21c1
Sequence:CCGGTGGGCTCAGACTCTAGCATATCTCGAGATATGCTAGAGTCTGAGCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-1657s21c1
Sequence:CCGGGACCAACTTGTCGTGACTATTCTCGAGAATAGTCACGACAAGTTGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-2385s21c1
Sequence:CCGGAGACGACAAGACGACGATAAACTCGAGTTTATCGTCGTCTTGTCGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-3535s21c1
Sequence:CCGGTTGGACGAGACTTTCGATTTCCTCGAGGAAATCGAAAGTCTCGTCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033319.1-4127s21c1
Sequence:CCGGATGTATATCCAGGCTATAAATCTCGAGATTTATAGCCTGGATATACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???