EMAIL THIS PAGE TO A FRIEND

PPFIA2

protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2

83 Gene Product Result for
Gene ID:
Human(8499) Summary: The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein is most closely related to PPFIA1, a liprin family member known to interact with the protein phosphatase LAR. The expression of this gene is found to be downregulated by androgens in a prostate cancer cell line. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2011]
Mouse(327814) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Rat(362876) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Zebrafish(566597) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
domestic cat(101092277) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Horse(100061038) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
dog(475415) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
chicken(417877) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
cow(536906) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
sheep(101104729) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
domestic guinea pig(100713587) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
naked mole-rat(101719006) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003625 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003625 Rosetta Predictions human pricing
NM_001108745 Rosetta Predictions rat pricing
NM_177373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171563 predicted 1825
2 SASI_Hs01_00171564 predicted 2531
3 SASI_Hs01_00171565 predicted 3507
4 SASI_Hs01_00171566 predicted 3351
5 SASI_Hs01_00171567 predicted 789
6 SASI_Hs02_00335971 predicted 3391
7 SASI_Hs01_00171570 predicted 2416
8 SASI_Hs02_00335972 predicted 2944
9 SASI_Hs02_00335973 predicted 1401
10 SASI_Hs01_00171572 predicted 3587
11 SASI_Hs01_00171568 predicted 3267
12 SASI_Hs01_00171569 predicted 3092
13 SASI_Hs01_00171571 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241665 predicted 877
2 SASI_Rn02_00241666 predicted 1861
3 SASI_Rn02_00241667 predicted 3339
4 SASI_Rn02_00241668 predicted 1503
5 SASI_Rn02_00241669 predicted 2091
6 SASI_Rn02_00241670 predicted 3327
7 SASI_Rn02_00241671 predicted 1531
8 SASI_Rn02_00241672 predicted 3440
9 SASI_Rn02_00241673 predicted 1178
10 SASI_Rn02_00241674 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022516 predicted 870
2 SASI_Mm01_00022517 predicted 2212
3 SASI_Mm01_00022518 predicted 1105
4 SASI_Mm01_00022519 predicted 1402
5 SASI_Mm01_00022520 predicted 1275
6 SASI_Mm01_00022521 predicted 3454
7 SASI_Mm01_00022522 predicted 2292
8 SASI_Mm01_00022524 predicted 3602
9 SASI_Mm01_00022525 predicted 3447
10 SASI_Mm02_00347532 predicted 1863
11 SASI_Mm01_00022523 predicted 2549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177373
PPFIA2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177373.3-4264s21c1
Sequence:CCGGAGAGCATCATCTACGTCATAACTCGAGTTATGACGTAGATGATGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177373.3-3573s21c1
Sequence:CCGGGTGGAGCAATGATCGAGTTATCTCGAGATAACTCGATCATTGCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177373.3-5030s1c1
Sequence:CCGGGCCAGACTCAAGTCTGTTATTCTCGAGAATAACAGACTTGAGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-1108s1c1
Sequence:CCGGGCCCAAATGAAAGAACGCTTACTCGAGTAAGCGTTCTTTCATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-1880s1c1
Sequence:CCGGCCACTATATCAAGAACTCATACTCGAGTATGAGTTCTTGATATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-568s1c1
Sequence:CCGGGCACTGACTAAAGAGTTGAATCTCGAGATTCAACTCTTTAGTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-2555s1c1
Sequence:CCGGCCACAATTAAATGCGAGACTTCTCGAGAAGTCTCGCATTTAATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177373
PPFIA2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177373.3-4264s21c1
Sequence:CCGGAGAGCATCATCTACGTCATAACTCGAGTTATGACGTAGATGATGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177373.3-3573s21c1
Sequence:CCGGGTGGAGCAATGATCGAGTTATCTCGAGATAACTCGATCATTGCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177373.3-5030s1c1
Sequence:CCGGGCCAGACTCAAGTCTGTTATTCTCGAGAATAACAGACTTGAGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-1108s1c1
Sequence:CCGGGCCCAAATGAAAGAACGCTTACTCGAGTAAGCGTTCTTTCATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-1880s1c1
Sequence:CCGGCCACTATATCAAGAACTCATACTCGAGTATGAGTTCTTGATATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-568s1c1
Sequence:CCGGGCACTGACTAAAGAGTTGAATCTCGAGATTCAACTCTTTAGTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-2555s1c1
Sequence:CCGGCCACAATTAAATGCGAGACTTCTCGAGAAGTCTCGCATTTAATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177373
PPFIA2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177373.3-4264s21c1
Sequence:CCGGAGAGCATCATCTACGTCATAACTCGAGTTATGACGTAGATGATGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177373.3-3573s21c1
Sequence:CCGGGTGGAGCAATGATCGAGTTATCTCGAGATAACTCGATCATTGCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177373.3-5030s1c1
Sequence:CCGGGCCAGACTCAAGTCTGTTATTCTCGAGAATAACAGACTTGAGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-1108s1c1
Sequence:CCGGGCCCAAATGAAAGAACGCTTACTCGAGTAAGCGTTCTTTCATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-1880s1c1
Sequence:CCGGCCACTATATCAAGAACTCATACTCGAGTATGAGTTCTTGATATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-568s1c1
Sequence:CCGGGCACTGACTAAAGAGTTGAATCTCGAGATTCAACTCTTTAGTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177373.3-2555s1c1
Sequence:CCGGCCACAATTAAATGCGAGACTTCTCGAGAAGTCTCGCATTTAATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003625
PPFIA2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-2999s21c1
Sequence:CCGGCAATCCACTGCATCGCTTAAACTCGAGTTTAAGCGATGCAGTGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-3482s21c1
Sequence:CCGGGTGGAGCAATGACCGAGTTATCTCGAGATAACTCGGTCATTGCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-3515s21c1
Sequence:CCGGAGCAATTGGACTTCGAGAATACTCGAGTATTCTCGAAGTCCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-599s21c1
Sequence:CCGGACGACATGAAAGATCACTAAGCTCGAGCTTAGTGATCTTTCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-562s1c1
Sequence:CCGGCAAGACTATTACTGGAGCATTCTCGAGAATGCTCCAGTAATAGTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2775s1c1
Sequence:CCGGGCTGAGAAGGATCGAAGACTACTCGAGTAGTCTTCGATCCTTCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2533s1c1
Sequence:CCGGCCTACCACAATGATGCTCGAACTCGAGTTCGAGCATCATTGTGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003625.x-4011s1c1
Sequence:CCGGCTAAGAAGACGAGCAGTGAAACTCGAGTTTCACTGCTCGTCTTCTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2266s1c1
Sequence:CCGGCCTCCATTACTGCCTCTGTTACTCGAGTAACAGAGGCAGTAATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003625
PPFIA2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-2999s21c1
Sequence:CCGGCAATCCACTGCATCGCTTAAACTCGAGTTTAAGCGATGCAGTGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-3482s21c1
Sequence:CCGGGTGGAGCAATGACCGAGTTATCTCGAGATAACTCGGTCATTGCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-3515s21c1
Sequence:CCGGAGCAATTGGACTTCGAGAATACTCGAGTATTCTCGAAGTCCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-599s21c1
Sequence:CCGGACGACATGAAAGATCACTAAGCTCGAGCTTAGTGATCTTTCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-562s1c1
Sequence:CCGGCAAGACTATTACTGGAGCATTCTCGAGAATGCTCCAGTAATAGTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2775s1c1
Sequence:CCGGGCTGAGAAGGATCGAAGACTACTCGAGTAGTCTTCGATCCTTCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2533s1c1
Sequence:CCGGCCTACCACAATGATGCTCGAACTCGAGTTCGAGCATCATTGTGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003625.x-4011s1c1
Sequence:CCGGCTAAGAAGACGAGCAGTGAAACTCGAGTTTCACTGCTCGTCTTCTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2266s1c1
Sequence:CCGGCCTCCATTACTGCCTCTGTTACTCGAGTAACAGAGGCAGTAATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003625
PPFIA2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-2999s21c1
Sequence:CCGGCAATCCACTGCATCGCTTAAACTCGAGTTTAAGCGATGCAGTGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-3482s21c1
Sequence:CCGGGTGGAGCAATGACCGAGTTATCTCGAGATAACTCGGTCATTGCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-3515s21c1
Sequence:CCGGAGCAATTGGACTTCGAGAATACTCGAGTATTCTCGAAGTCCAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003625.2-599s21c1
Sequence:CCGGACGACATGAAAGATCACTAAGCTCGAGCTTAGTGATCTTTCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-562s1c1
Sequence:CCGGCAAGACTATTACTGGAGCATTCTCGAGAATGCTCCAGTAATAGTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2775s1c1
Sequence:CCGGGCTGAGAAGGATCGAAGACTACTCGAGTAGTCTTCGATCCTTCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2533s1c1
Sequence:CCGGCCTACCACAATGATGCTCGAACTCGAGTTCGAGCATCATTGTGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003625.x-4011s1c1
Sequence:CCGGCTAAGAAGACGAGCAGTGAAACTCGAGTTTCACTGCTCGTCTTCTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003625.x-2266s1c1
Sequence:CCGGCCTCCATTACTGCCTCTGTTACTCGAGTAACAGAGGCAGTAATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)