EMAIL THIS PAGE TO A FRIEND

PPFIA3

protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3

110 Gene Product Result for
Synonyms: LPNA3
UniProtKB ID: O75145, A8K142, Q3MJA0, Q9H8B5, Q9UEW4
Gene ID:
Human(8541) Summary: The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. Liprin family protein has been shown to localize phosphatase LAR to cell focal adhesions and may be involved in the molecular organization of presynaptic active zones. [provided by RefSeq, Jul 2008]
Mouse(76787) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Rat(140591) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
naked mole-rat(101708879) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
domestic guinea pig(100729056) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
cow(505162) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
sheep(101109825) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Zebrafish(567230) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
domestic cat(101083310) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
dog(484387) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003660 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100881 MISSION® esiRNA esiRNA human AE000659.1 (esiRNA2) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003660 Rosetta Predictions human pricing
XM_001080725 Rosetta Predictions rat pricing
XM_341856 Rosetta Predictions rat pricing
NM_029741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336041 predicted 3365
2 SASI_Hs01_00182700 predicted 3333
3 SASI_Hs01_00182701 predicted 2760
4 SASI_Hs01_00182702 predicted 3342
5 SASI_Hs01_00182703 predicted 2779
6 SASI_Hs01_00182704 predicted 1585
7 SASI_Hs01_00182705 predicted 1743
8 SASI_Hs01_00182706 predicted 1228
9 SASI_Hs01_00182707 predicted 3246
10 SASI_Hs01_00182709 predicted 1329
11 SASI_Hs01_00182708 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369080 predicted 3514
2 SASI_Rn02_00369081 predicted 3491
3 SASI_Rn02_00369082 predicted 1742
4 SASI_Rn02_00369083 predicted 1811
5 SASI_Rn02_00369084 predicted 3583
6 SASI_Rn02_00369085 predicted 3149
7 SASI_Rn02_00369086 predicted 756
8 SASI_Rn02_00369087 predicted 3185
9 SASI_Rn02_00369088 predicted 751
10 SASI_Rn02_00369089 predicted 3393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393493 predicted 4180
2 SASI_Rn02_00393494 predicted 4193
3 SASI_Rn02_00393495 predicted 4150
4 SASI_Rn02_00393496 predicted 4178
5 SASI_Rn02_00393497 predicted 4219
6 SASI_Rn02_00393498 predicted 4179
7 SASI_Rn02_00393499 predicted 4173
8 SASI_Rn02_00393500 predicted 4151
9 SASI_Rn02_00393501 predicted 4178
10 SASI_Rn02_00393502 predicted 4189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176995 predicted 880
2 SASI_Mm01_00176992 predicted 3539
3 SASI_Mm01_00176993 predicted 3193
4 SASI_Mm01_00176994 predicted 3767
5 SASI_Mm02_00335840 predicted 883
6 SASI_Mm02_00335841 predicted 1359
7 SASI_Mm01_00176996 predicted 3288
8 SASI_Mm01_00176997 predicted 639
9 SASI_Mm01_00176998 predicted 1706
10 SASI_Mm01_00176999 predicted 636
11 SASI_Mm01_00176990 predicted 825
12 SASI_Mm01_00176991 predicted 3044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029741
PPFIA3 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029741.1-3534s1c1
Sequence:CCGGCCTGGACCAAACCATAAGAAACTCGAGTTTCTTATGGTTTGGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-1229s1c1
Sequence:CCGGGCTAACATGAAGAAACTTCAACTCGAGTTGAAGTTTCTTCATGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-2992s1c1
Sequence:CCGGCCTGAAGGAATTTGCTACGAACTCGAGTTCGTAGCAAATTCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-2854s1c1
Sequence:CCGGCTATGGTATTATGTGCCTGAACTCGAGTTCAGGCACATAATACCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-1160s1c1
Sequence:CCGGCGGTTACAGCTTCACCTCAAACTCGAGTTTGAGGTGAAGCTGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029741
PPFIA3 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029741.1-3534s1c1
Sequence:CCGGCCTGGACCAAACCATAAGAAACTCGAGTTTCTTATGGTTTGGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-1229s1c1
Sequence:CCGGGCTAACATGAAGAAACTTCAACTCGAGTTGAAGTTTCTTCATGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-2992s1c1
Sequence:CCGGCCTGAAGGAATTTGCTACGAACTCGAGTTCGTAGCAAATTCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-2854s1c1
Sequence:CCGGCTATGGTATTATGTGCCTGAACTCGAGTTCAGGCACATAATACCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-1160s1c1
Sequence:CCGGCGGTTACAGCTTCACCTCAAACTCGAGTTTGAGGTGAAGCTGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029741
PPFIA3 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029741.1-3534s1c1
Sequence:CCGGCCTGGACCAAACCATAAGAAACTCGAGTTTCTTATGGTTTGGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-1229s1c1
Sequence:CCGGGCTAACATGAAGAAACTTCAACTCGAGTTGAAGTTTCTTCATGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-2992s1c1
Sequence:CCGGCCTGAAGGAATTTGCTACGAACTCGAGTTCGTAGCAAATTCCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-2854s1c1
Sequence:CCGGCTATGGTATTATGTGCCTGAACTCGAGTTCAGGCACATAATACCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029741.1-1160s1c1
Sequence:CCGGCGGTTACAGCTTCACCTCAAACTCGAGTTTGAGGTGAAGCTGTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003660
VALIDATED
PPFIA3 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003660.x-3273s1c1
Sequence:CCGGGCTCGAATGTTAGATCACCTTCTCGAGAAGGTGATCTAACATTCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-2612s1c1
Sequence:CCGGGAAGAGCATCAAGTCATCCATCTCGAGATGGATGACTTGATGCTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-1495s1c1
Sequence:CCGGCCGAGGAACGTCATGGGAATTCTCGAGAATTCCCATGACGTTCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-1241s1c1
Sequence:CCGGGCGGATTACAACACTGGAGAACTCGAGTTCTCCAGTGTTGTAATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003660.x-4694s1c1
Sequence:CCGGTCACGGGTAAAGAGAACTGTTCTCGAGAACAGTTCTCTTTACCCGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-3370s21c1
Sequence:GTACCGGGCCTGAAACGGCTCAACTATGCTCGAGCATAGTTGAGCCGTTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1596s21c1
Sequence:CCGGATGAACGATGACCACAATAAGCTCGAGCTTATTGTGGTCATCGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1333s21c1
Sequence:CCGGCTAGCAAGGAGTCGTTGTATCCTCGAGGATACAACGACTCCTTGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-586s21c1
Sequence:CCGGTGACGAAGGAGCTGAACTTATCTCGAGATAAGTTCAGCTCCTTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003660.2-3934s21c1
Sequence:CCGGACCTCACTCGGACGGAAGAATCTCGAGATTCTTCCGTCCGAGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-782s21c1
Sequence:GTACCGGAGAAGTGCTCAAAGCTCTAAACTCGAGTTTAGAGCTTTGAGCACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003660.2-4322s21c1
Sequence:GTACCGGTCTTCCTTCTTCGTCCGAAAGCTCGAGCTTTCGGACGAAGAAGGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1495s21c1
Sequence:CCGGCCGAGGAACGTCATGGGAATTCTCGAGAATTCCCATGACGTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003660
VALIDATED
PPFIA3 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003660.x-3273s1c1
Sequence:CCGGGCTCGAATGTTAGATCACCTTCTCGAGAAGGTGATCTAACATTCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-2612s1c1
Sequence:CCGGGAAGAGCATCAAGTCATCCATCTCGAGATGGATGACTTGATGCTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-1495s1c1
Sequence:CCGGCCGAGGAACGTCATGGGAATTCTCGAGAATTCCCATGACGTTCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-1241s1c1
Sequence:CCGGGCGGATTACAACACTGGAGAACTCGAGTTCTCCAGTGTTGTAATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003660.x-4694s1c1
Sequence:CCGGTCACGGGTAAAGAGAACTGTTCTCGAGAACAGTTCTCTTTACCCGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-3370s21c1
Sequence:GTACCGGGCCTGAAACGGCTCAACTATGCTCGAGCATAGTTGAGCCGTTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1596s21c1
Sequence:CCGGATGAACGATGACCACAATAAGCTCGAGCTTATTGTGGTCATCGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1333s21c1
Sequence:CCGGCTAGCAAGGAGTCGTTGTATCCTCGAGGATACAACGACTCCTTGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-586s21c1
Sequence:CCGGTGACGAAGGAGCTGAACTTATCTCGAGATAAGTTCAGCTCCTTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003660.2-3934s21c1
Sequence:CCGGACCTCACTCGGACGGAAGAATCTCGAGATTCTTCCGTCCGAGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-782s21c1
Sequence:GTACCGGAGAAGTGCTCAAAGCTCTAAACTCGAGTTTAGAGCTTTGAGCACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003660.2-4322s21c1
Sequence:GTACCGGTCTTCCTTCTTCGTCCGAAAGCTCGAGCTTTCGGACGAAGAAGGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1495s21c1
Sequence:CCGGCCGAGGAACGTCATGGGAATTCTCGAGAATTCCCATGACGTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003660
VALIDATED
PPFIA3 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003660.x-3273s1c1
Sequence:CCGGGCTCGAATGTTAGATCACCTTCTCGAGAAGGTGATCTAACATTCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-2612s1c1
Sequence:CCGGGAAGAGCATCAAGTCATCCATCTCGAGATGGATGACTTGATGCTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-1495s1c1
Sequence:CCGGCCGAGGAACGTCATGGGAATTCTCGAGAATTCCCATGACGTTCCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003660.x-1241s1c1
Sequence:CCGGGCGGATTACAACACTGGAGAACTCGAGTTCTCCAGTGTTGTAATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003660.x-4694s1c1
Sequence:CCGGTCACGGGTAAAGAGAACTGTTCTCGAGAACAGTTCTCTTTACCCGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-3370s21c1
Sequence:GTACCGGGCCTGAAACGGCTCAACTATGCTCGAGCATAGTTGAGCCGTTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1596s21c1
Sequence:CCGGATGAACGATGACCACAATAAGCTCGAGCTTATTGTGGTCATCGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1333s21c1
Sequence:CCGGCTAGCAAGGAGTCGTTGTATCCTCGAGGATACAACGACTCCTTGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-586s21c1
Sequence:CCGGTGACGAAGGAGCTGAACTTATCTCGAGATAAGTTCAGCTCCTTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003660.2-3934s21c1
Sequence:CCGGACCTCACTCGGACGGAAGAATCTCGAGATTCTTCCGTCCGAGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-782s21c1
Sequence:GTACCGGAGAAGTGCTCAAAGCTCTAAACTCGAGTTTAGAGCTTTGAGCACTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003660.2-4322s21c1
Sequence:GTACCGGTCTTCCTTCTTCGTCCGAAAGCTCGAGCTTTCGGACGAAGAAGGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003660.2-1495s21c1
Sequence:CCGGCCGAGGAACGTCATGGGAATTCTCGAGAATTCCCATGACGTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)