EMAIL THIS PAGE TO A FRIEND

PPFIBP1

PTPRF interacting protein, binding protein 1 (liprin beta 1)

98 Gene Product Result for
Synonyms: L2 SGT2 hSGT2 hSgt2p
UniProtKB ID: Q86W92, O75336, Q86X70, Q9NY03, Q9ULJ0
Gene ID:
Human(8496) Summary: The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein was found to interact with S100A4, a calcium-binding protein related to tumor invasiveness and metastasis. In vitro experiment demonstrated that the interaction inhibited the phosphorylation of this protein by protein kinase C and protein kinase CK2. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(67533) PTPRF interacting protein, binding protein 1 (liprin beta 1)
Rat(312855) PTPRF interacting protein, binding protein 1 (liprin beta 1)
naked mole-rat(101715740) PTPRF interacting protein, binding protein 1 (liprin beta 1)
Domestic Rabbit(100342629) PTPRF interacting protein, binding protein 1 (liprin beta 1)
domestic guinea pig(100734144) PTPRF interacting protein, binding protein 1 (liprin beta 1)
cow(407130) PTPRF interacting protein, binding protein 1 (liprin beta 1)
sheep(101110491) PTPRF interacting protein, binding protein 1 (liprin beta 1)
Zebrafish(100329686) PTPRF interacting protein, binding protein 1 (liprin beta 1)
dog(486623) PTPRF interacting protein, binding protein 1 (liprin beta 1)
Horse(100064684) PTPRF interacting protein, binding protein 1 (liprin beta 1)
domestic cat(101082578) PTPRF interacting protein, binding protein 1 (liprin beta 1)
chicken(418219) PTPRF interacting protein, binding protein 1 (liprin beta 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048301 MISSION® esiRNA targeting mouse Ppfibp1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003622 Rosetta Predictions human pricing
NM_177444 Rosetta Predictions human pricing
NM_001107896 Rosetta Predictions rat pricing
NM_026221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236836 predicted 508
2 SASI_Hs01_00236837 predicted 602
3 SASI_Hs01_00236838 predicted 427
4 SASI_Hs01_00236839 predicted 437
5 SASI_Hs01_00236840 predicted 410
6 SASI_Hs01_00236842 predicted 582
7 SASI_Hs01_00236843 predicted 446
8 SASI_Hs02_00335969 predicted 445
9 SASI_Hs01_00236845 predicted 427
10 SASI_Hs02_00335970 predicted 375
11 SASI_Hs01_00236841 predicted 538
12 SASI_Hs01_00236844 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050254 predicted 513
2 SASI_Hs01_00050255 predicted 606
3 SASI_Hs01_00050256 predicted 422
4 SASI_Hs01_00050257 predicted 440
5 SASI_Hs01_00050258 predicted 411
6 SASI_Hs01_00050260 predicted 574
7 SASI_Hs01_00050261 predicted 451
8 SASI_Hs02_00369342 predicted 449
9 SASI_Hs01_00050263 predicted 429
10 SASI_Hs02_00369343 predicted 375
11 SASI_Hs01_00050259 predicted 542
12 SASI_Hs01_00050262 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233345 predicted 1408
2 SASI_Rn02_00233346 predicted 804
3 SASI_Rn02_00233347 predicted 2888
4 SASI_Rn02_00233348 predicted 2585
5 SASI_Rn02_00233349 predicted 1825
6 SASI_Rn02_00233350 predicted 442
7 SASI_Rn02_00233351 predicted 1178
8 SASI_Rn02_00233352 predicted 327
9 SASI_Rn02_00233353 predicted 561
10 SASI_Rn02_00233354 predicted 2587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107993 predicted 902
2 SASI_Mm02_00329898 predicted 1089
3 SASI_Mm01_00107994 predicted 964
4 SASI_Mm01_00107995 predicted 675
5 SASI_Mm01_00107996 predicted 2710
6 SASI_Mm01_00107998 predicted 2315
7 SASI_Mm01_00107999 predicted 3178
8 SASI_Mm01_00108000 predicted 922
9 SASI_Mm01_00108001 predicted 624
10 SASI_Mm02_00329899 predicted 3048
11 SASI_Mm01_00107992 predicted 896
12 SASI_Mm01_00107997 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003622
VALIDATED
PPFIBP1 MISSION shRNA Bacterial Glycerol Stock
PTPRF interacting protein, binding protein 1 (liprin beta 1)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-542s1c1
Sequence:CCGGGCGTGGATTGTTAGAGATGATCTCGAGATCATCTCTAACAATCCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3231s1c1
Sequence:CCGGCGGTTAGAGCAGATGGAAGATCTCGAGATCTTCCATCTGCTCTAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3676s1c1
Sequence:CCGGCCAGAGTGTTTCCATTCATATCTCGAGATATGAATGGAAACACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3051s1c1
Sequence:CCGGGCCAAAGTGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCACTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-3676s21c1
Sequence:CCGGCCAGAGTGTTTCCATTCATATCTCGAGATATGAATGGAAACACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-1529s21c1
Sequence:CCGGTACTACCATCTTGCAAGTTTCCTCGAGGAAACTTGCAAGATGGTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-1947s21c1
Sequence:GTACCGGGCACCAAACTTAGATCGTAAACTCGAGTTTACGATCTAAGTTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003622.x-2559s1c1
Sequence:CCGGCCTCAATATAAGACCCAGTTTCTCGAGAAACTGGGTCTTATATTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003622.2-542s21c1
Sequence:CCGGGCGTGGATTGTTAGAGATGATCTCGAGATCATCTCTAACAATCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-3051s21c1
Sequence:CCGGGCCAAAGTGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-2549s21c1
Sequence:CCGGCATTGGCCTCCCTCAATATAACTCGAGTTATATTGAGGGAGGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003622
VALIDATED
PPFIBP1 MISSION shRNA shRNA Plasmid DNA
PTPRF interacting protein, binding protein 1 (liprin beta 1)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-542s1c1
Sequence:CCGGGCGTGGATTGTTAGAGATGATCTCGAGATCATCTCTAACAATCCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3231s1c1
Sequence:CCGGCGGTTAGAGCAGATGGAAGATCTCGAGATCTTCCATCTGCTCTAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3676s1c1
Sequence:CCGGCCAGAGTGTTTCCATTCATATCTCGAGATATGAATGGAAACACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3051s1c1
Sequence:CCGGGCCAAAGTGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCACTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-3676s21c1
Sequence:CCGGCCAGAGTGTTTCCATTCATATCTCGAGATATGAATGGAAACACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-1529s21c1
Sequence:CCGGTACTACCATCTTGCAAGTTTCCTCGAGGAAACTTGCAAGATGGTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-1947s21c1
Sequence:GTACCGGGCACCAAACTTAGATCGTAAACTCGAGTTTACGATCTAAGTTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003622.x-2559s1c1
Sequence:CCGGCCTCAATATAAGACCCAGTTTCTCGAGAAACTGGGTCTTATATTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003622.2-542s21c1
Sequence:CCGGGCGTGGATTGTTAGAGATGATCTCGAGATCATCTCTAACAATCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-3051s21c1
Sequence:CCGGGCCAAAGTGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-2549s21c1
Sequence:CCGGCATTGGCCTCCCTCAATATAACTCGAGTTATATTGAGGGAGGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003622
VALIDATED
PPFIBP1 MISSION shRNA Lentiviral Transduction Particles
PTPRF interacting protein, binding protein 1 (liprin beta 1)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-542s1c1
Sequence:CCGGGCGTGGATTGTTAGAGATGATCTCGAGATCATCTCTAACAATCCACGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3231s1c1
Sequence:CCGGCGGTTAGAGCAGATGGAAGATCTCGAGATCTTCCATCTGCTCTAACCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3676s1c1
Sequence:CCGGCCAGAGTGTTTCCATTCATATCTCGAGATATGAATGGAAACACTCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003622.x-3051s1c1
Sequence:CCGGGCCAAAGTGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCACTTTGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-3676s21c1
Sequence:CCGGCCAGAGTGTTTCCATTCATATCTCGAGATATGAATGGAAACACTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-1529s21c1
Sequence:CCGGTACTACCATCTTGCAAGTTTCCTCGAGGAAACTTGCAAGATGGTAGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-1947s21c1
Sequence:GTACCGGGCACCAAACTTAGATCGTAAACTCGAGTTTACGATCTAAGTTTGGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003622.x-2559s1c1
Sequence:CCGGCCTCAATATAAGACCCAGTTTCTCGAGAAACTGGGTCTTATATTGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003622.2-542s21c1
Sequence:CCGGGCGTGGATTGTTAGAGATGATCTCGAGATCATCTCTAACAATCCACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-3051s21c1
Sequence:CCGGGCCAAAGTGAAGCCAAAGAAACTCGAGTTTCTTTGGCTTCACTTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000338307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003622.2-2549s21c1
Sequence:CCGGCATTGGCCTCCCTCAATATAACTCGAGTTATATTGAGGGAGGCCAATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026221
PPFIBP1 MISSION shRNA Bacterial Glycerol Stock
PTPRF interacting protein, binding protein 1 (liprin beta 1)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-1097s1c1
Sequence:CCGGCGAGACATTGAAGTACAGAAACTCGAGTTTCTGTACTTCAATGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-340s1c1
Sequence:CCGGCGGAATCATAGCAGGTTCTAACTCGAGTTAGAACCTGCTATGATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-2702s1c1
Sequence:CCGGGTAGAAACTATGGCCCAGTTACTCGAGTAACTGGGCCATAGTTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026221.1-3933s1c1
Sequence:CCGGGCACTCATATACCCATCAGAACTCGAGTTCTGATGGGTATATGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026221.1-4029s1c1
Sequence:CCGGCCTTTGCTAAACTCATCATTACTCGAGTAATGATGAGTTTAGCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026221
PPFIBP1 MISSION shRNA shRNA Plasmid DNA
PTPRF interacting protein, binding protein 1 (liprin beta 1)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-1097s1c1
Sequence:CCGGCGAGACATTGAAGTACAGAAACTCGAGTTTCTGTACTTCAATGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-340s1c1
Sequence:CCGGCGGAATCATAGCAGGTTCTAACTCGAGTTAGAACCTGCTATGATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-2702s1c1
Sequence:CCGGGTAGAAACTATGGCCCAGTTACTCGAGTAACTGGGCCATAGTTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026221.1-3933s1c1
Sequence:CCGGGCACTCATATACCCATCAGAACTCGAGTTCTGATGGGTATATGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026221.1-4029s1c1
Sequence:CCGGCCTTTGCTAAACTCATCATTACTCGAGTAATGATGAGTTTAGCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026221
PPFIBP1 MISSION shRNA Lentiviral Transduction Particles
PTPRF interacting protein, binding protein 1 (liprin beta 1)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-1097s1c1
Sequence:CCGGCGAGACATTGAAGTACAGAAACTCGAGTTTCTGTACTTCAATGTCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-340s1c1
Sequence:CCGGCGGAATCATAGCAGGTTCTAACTCGAGTTAGAACCTGCTATGATTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026221.1-2702s1c1
Sequence:CCGGGTAGAAACTATGGCCCAGTTACTCGAGTAACTGGGCCATAGTTTCTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026221.1-3933s1c1
Sequence:CCGGGCACTCATATACCCATCAGAACTCGAGTTCTGATGGGTATATGAGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000197523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026221.1-4029s1c1
Sequence:CCGGCCTTTGCTAAACTCATCATTACTCGAGTAATGATGAGTTTAGCAAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???