EMAIL THIS PAGE TO A FRIEND

PPHLN1

periphilin 1

117 Gene Product Result for
Synonyms: HSPC232
Gene ID:
Human(51535) Summary: The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(223828) periphilin 1
Rat(366975) periphilin 1
cow(532695) periphilin 1
sheep(101115951) periphilin 1
Zebrafish(790935) periphilin 1
chicken(417792) periphilin 1
Horse(100054208) periphilin 1
dog(477639) periphilin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016488 Rosetta Predictions human pricing
NM_201438 Rosetta Predictions human pricing
NM_201439 Rosetta Predictions human pricing
NM_201440 Rosetta Predictions human pricing
NM_201515 Rosetta Predictions human pricing
NM_001108992 Rosetta Predictions rat pricing
NM_001083114 Rosetta Predictions mouse pricing
NM_146062 Rosetta Predictions mouse pricing
NM_175363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147322 predicted 594
2 SASI_Hs01_00147323 predicted 743
3 SASI_Hs01_00147324 predicted 714
4 SASI_Hs01_00147325 predicted 718
5 SASI_Hs01_00147326 predicted 655
6 SASI_Hs01_00147327 predicted 578
7 SASI_Hs01_00147328 predicted 627
8 SASI_Hs01_00147329 predicted 632
9 SASI_Hs01_00147330 predicted 607
10 SASI_Hs01_00147331 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020341 predicted 467
2 SASI_Hs01_00020342 predicted 616
3 SASI_Hs01_00020343 predicted 594
4 SASI_Hs01_00020344 predicted 605
5 SASI_Hs01_00020345 predicted 527
6 SASI_Hs01_00020346 predicted 454
7 SASI_Hs01_00020347 predicted 509
8 SASI_Hs01_00020348 predicted 507
9 SASI_Hs01_00020349 predicted 482
10 SASI_Hs01_00020350 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090409 predicted 592
2 SASI_Hs01_00090410 predicted 739
3 SASI_Hs01_00090411 predicted 716
4 SASI_Hs01_00090412 predicted 725
5 SASI_Hs01_00090413 predicted 658
6 SASI_Hs01_00090414 predicted 579
7 SASI_Hs01_00090415 predicted 630
8 SASI_Hs01_00090416 predicted 637
9 SASI_Hs01_00090417 predicted 609
10 SASI_Hs01_00090418 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231131 predicted 472
2 SASI_Hs01_00231132 predicted 618
3 SASI_Hs01_00231133 predicted 589
4 SASI_Hs01_00231134 predicted 597
5 SASI_Hs01_00231135 predicted 528
6 SASI_Hs01_00231136 predicted 455
7 SASI_Hs01_00231137 predicted 513
8 SASI_Hs01_00231138 predicted 512
9 SASI_Hs01_00231139 predicted 481
10 SASI_Hs01_00231140 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212131 predicted 635
2 SASI_Hs01_00212132 predicted 785
3 SASI_Hs01_00212133 predicted 761
4 SASI_Hs01_00212134 predicted 768
5 SASI_Hs01_00212135 predicted 701
6 SASI_Hs01_00212136 predicted 619
7 SASI_Hs01_00212137 predicted 677
8 SASI_Hs01_00212138 predicted 680
9 SASI_Hs01_00212139 predicted 644
10 SASI_Hs01_00212140 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244104 predicted 774
2 SASI_Rn02_00244105 predicted 1189
3 SASI_Rn02_00244106 predicted 1109
4 SASI_Rn02_00244107 predicted 1047
5 SASI_Rn02_00244108 predicted 639
6 SASI_Rn02_00244109 predicted 900
7 SASI_Rn02_00244110 predicted 622
8 SASI_Rn02_00244111 predicted 621
9 SASI_Rn02_00244112 predicted 486
10 SASI_Rn02_00244113 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299464 predicted 1115
2 SASI_Mm02_00299465 predicted 692
3 SASI_Mm02_00299466 predicted 710
4 SASI_Mm02_00299467 predicted 823
5 SASI_Mm02_00299468 predicted 765
6 SASI_Mm02_00299469 predicted 907
7 SASI_Mm02_00299470 predicted 907
8 SASI_Mm02_00299471 predicted 685
9 SASI_Mm02_00299472 predicted 802
10 SASI_Mm02_00299473 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341674 predicted 1383
2 SASI_Mm01_00158911 predicted 949
3 SASI_Mm01_00158912 predicted 968
4 SASI_Mm02_00341675 predicted 1085
5 SASI_Mm01_00158915 predicted 1028
6 SASI_Mm02_00341676 predicted 1170
7 SASI_Mm02_00341677 predicted 1171
8 SASI_Mm01_00158916 predicted 946
9 SASI_Mm02_00341678 predicted 1067
10 SASI_Mm02_00341679 predicted 1172
11 SASI_Mm01_00158910 predicted 869
12 SASI_Mm01_00158913 predicted 679
13 SASI_Mm01_00158914 predicted 873
14 SASI_Mm01_00158917 predicted 573
15 SASI_Mm01_00158918 predicted 946
16 SASI_Mm01_00158919 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064239 predicted 702
2 SASI_Mm01_00064240 predicted 749
3 SASI_Mm01_00064241 predicted 768
4 SASI_Mm01_00064242 predicted 517
5 SASI_Mm02_00346162 predicted 854
6 SASI_Mm02_00346163 predicted 560
7 SASI_Mm01_00064247 predicted 790
8 SASI_Mm02_00346164 predicted 957
9 SASI_Mm02_00346165 predicted 1031
10 SASI_Mm01_00064248 predicted 795
11 SASI_Mm01_00064243 predicted 704
12 SASI_Mm01_00064244 predicted 821
13 SASI_Mm01_00064245 predicted 744
14 SASI_Mm01_00064246 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016488
VALIDATED
PPHLN1 MISSION shRNA Bacterial Glycerol Stock
periphilin 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-838s1c1
Sequence:CCGGGATGAAAGTAACTTGCCTGAACTCGAGTTCAGGCAAGTTACTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-390s1c1
Sequence:CCGGGCAACCTGAATACAGGGACATCTCGAGATGTCCCTGTATTCAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-916s1c1
Sequence:CCGGCCTGAGTCAAACACAACACATCTCGAGATGTGTTGTGTTTGACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-725s1c1
Sequence:CCGGCAAGTGGTTCAGCAGTTTCTTCTCGAGAAGAAACTGCTGAACCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-341s1c1
Sequence:CCGGGAGATGAATCTGGTTATAGATCTCGAGATCTATAACCAGATTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-235s1c1
Sequence:CCGGCCTGGTGAAGGAAGCTACAATCTCGAGATTGTAGCTTCCTTCACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-998s1c1
Sequence:CCGGCCAAAGAGATTGAACAGGTTTCTCGAGAAACCTGTTCAATCTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-646s1c1
Sequence:CCGGCGGCAGAATGAAGGAAATCCTCTCGAGAGGATTTCCTTCATTCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-1175s1c1
Sequence:CCGGCTGAAATGGATCACGACGGAACTCGAGTTCCGTCGTGATCCATTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-557s1c1
Sequence:CCGGGCAGAAGCTACTCTCCAGAAACTCGAGTTTCTGGAGAGTAGCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-359s1c1
Sequence:CCGGGATGGACAAGAGACGATCATTCTCGAGAATGATCGTCTCTTGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-268s1c1
Sequence:CCGGCATGTTGATTACCGAGACTATCTCGAGATAGTCTCGGTAATCAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-178s1c1
Sequence:CCGGGATGGCTACAATAGACTAGTTCTCGAGAACTAGTCTATTGTAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-974s1c1
Sequence:CCGGGCTCTAAAGCAATAGCATCAACTCGAGTTGATGCTATTGCTTTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016488
VALIDATED
PPHLN1 MISSION shRNA shRNA Plasmid DNA
periphilin 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-838s1c1
Sequence:CCGGGATGAAAGTAACTTGCCTGAACTCGAGTTCAGGCAAGTTACTTTCATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000142426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-390s1c1
Sequence:CCGGGCAACCTGAATACAGGGACATCTCGAGATGTCCCTGTATTCAGGTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000143410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-916s1c1
Sequence:CCGGCCTGAGTCAAACACAACACATCTCGAGATGTGTTGTGTTTGACTCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000143154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-725s1c1
Sequence:CCGGCAAGTGGTTCAGCAGTTTCTTCTCGAGAAGAAACTGCTGAACCACTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000121654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-341s1c1
Sequence:CCGGGAGATGAATCTGGTTATAGATCTCGAGATCTATAACCAGATTCATCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000122511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-235s1c1
Sequence:CCGGCCTGGTGAAGGAAGCTACAATCTCGAGATTGTAGCTTCCTTCACCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000122086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-998s1c1
Sequence:CCGGCCAAAGAGATTGAACAGGTTTCTCGAGAAACCTGTTCAATCTCTTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000141073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-646s1c1
Sequence:CCGGCGGCAGAATGAAGGAAATCCTCTCGAGAGGATTTCCTTCATTCTGCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000141400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-1175s1c1
Sequence:CCGGCTGAAATGGATCACGACGGAACTCGAGTTCCGTCGTGATCCATTTCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000141987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-557s1c1
Sequence:CCGGGCAGAAGCTACTCTCCAGAAACTCGAGTTTCTGGAGAGTAGCTTCTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000143192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-359s1c1
Sequence:CCGGGATGGACAAGAGACGATCATTCTCGAGAATGATCGTCTCTTGTCCATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000144374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-268s1c1
Sequence:CCGGCATGTTGATTACCGAGACTATCTCGAGATAGTCTCGGTAATCAACATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000144627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-178s1c1
Sequence:CCGGGATGGCTACAATAGACTAGTTCTCGAGAACTAGTCTATTGTAGCCATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000144709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-974s1c1
Sequence:CCGGGCTCTAAAGCAATAGCATCAACTCGAGTTGATGCTATTGCTTTAGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016488
VALIDATED
PPHLN1 MISSION shRNA Lentiviral Transduction Particles
periphilin 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-838s1c1
Sequence:CCGGGATGAAAGTAACTTGCCTGAACTCGAGTTCAGGCAAGTTACTTTCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000142426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-390s1c1
Sequence:CCGGGCAACCTGAATACAGGGACATCTCGAGATGTCCCTGTATTCAGGTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-916s1c1
Sequence:CCGGCCTGAGTCAAACACAACACATCTCGAGATGTGTTGTGTTTGACTCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-725s1c1
Sequence:CCGGCAAGTGGTTCAGCAGTTTCTTCTCGAGAAGAAACTGCTGAACCACTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-341s1c1
Sequence:CCGGGAGATGAATCTGGTTATAGATCTCGAGATCTATAACCAGATTCATCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000122511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-235s1c1
Sequence:CCGGCCTGGTGAAGGAAGCTACAATCTCGAGATTGTAGCTTCCTTCACCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000122086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-998s1c1
Sequence:CCGGCCAAAGAGATTGAACAGGTTTCTCGAGAAACCTGTTCAATCTCTTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-646s1c1
Sequence:CCGGCGGCAGAATGAAGGAAATCCTCTCGAGAGGATTTCCTTCATTCTGCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-1175s1c1
Sequence:CCGGCTGAAATGGATCACGACGGAACTCGAGTTCCGTCGTGATCCATTTCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_016488.4-557s1c1
Sequence:CCGGGCAGAAGCTACTCTCCAGAAACTCGAGTTTCTGGAGAGTAGCTTCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-359s1c1
Sequence:CCGGGATGGACAAGAGACGATCATTCTCGAGAATGATCGTCTCTTGTCCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-268s1c1
Sequence:CCGGCATGTTGATTACCGAGACTATCTCGAGATAGTCTCGGTAATCAACATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016488.4-178s1c1
Sequence:CCGGGATGGCTACAATAGACTAGTTCTCGAGAACTAGTCTATTGTAGCCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016488.4-974s1c1
Sequence:CCGGGCTCTAAAGCAATAGCATCAACTCGAGTTGATGCTATTGCTTTAGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175363
VALIDATED
PPHLN1 MISSION shRNA Bacterial Glycerol Stock
periphilin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-521s21c1
Sequence:CCGGCAATTCGTGGAAGAGGTAAAGCTCGAGCTTTACCTCTTCCACGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-1112s1c1
Sequence:CCGGCCTTGGATTGTGTAAATCCTTCTCGAGAAGGATTTACACAATCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-693s1c1
Sequence:CCGGGACGAAAGTAACTTGGCTGAACTCGAGTTCAGCCAAGTTACTTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-678s1c1
Sequence:CCGGACACTAGAGAAGTCAGACGAACTCGAGTTCGTCTGACTTCTCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-771s1c1
Sequence:CCGGCCCGAGTCAAACACAGTAGATCTCGAGATCTACTGTGTTTGACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-853s1c1
Sequence:CCGGCCAAAGAGATTGAGCAGGTTTCTCGAGAAACCTGCTCAATCTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-971s21c1
Sequence:CCGGGGCAGAACTTACACGAGATAGCTCGAGCTATCTCGTGTAAGTTCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-222s21c1
Sequence:CCGGATGGCTAAGAGATGATCATTCCTCGAGGAATGATCATCTCTTAGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-739s21c1
Sequence:CCGGGGATCCACGGCACCCTTATTTCTCGAGAAATAAGGGTGCCGTGGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175363
VALIDATED
PPHLN1 MISSION shRNA shRNA Plasmid DNA
periphilin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-521s21c1
Sequence:CCGGCAATTCGTGGAAGAGGTAAAGCTCGAGCTTTACCTCTTCCACGAATTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-1112s1c1
Sequence:CCGGCCTTGGATTGTGTAAATCCTTCTCGAGAAGGATTTACACAATCCAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-693s1c1
Sequence:CCGGGACGAAAGTAACTTGGCTGAACTCGAGTTCAGCCAAGTTACTTTCGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-678s1c1
Sequence:CCGGACACTAGAGAAGTCAGACGAACTCGAGTTCGTCTGACTTCTCTAGTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-771s1c1
Sequence:CCGGCCCGAGTCAAACACAGTAGATCTCGAGATCTACTGTGTTTGACTCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-853s1c1
Sequence:CCGGCCAAAGAGATTGAGCAGGTTTCTCGAGAAACCTGCTCAATCTCTTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000437242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-971s21c1
Sequence:CCGGGGCAGAACTTACACGAGATAGCTCGAGCTATCTCGTGTAAGTTCTGCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-222s21c1
Sequence:CCGGATGGCTAAGAGATGATCATTCCTCGAGGAATGATCATCTCTTAGCCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000427002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-739s21c1
Sequence:CCGGGGATCCACGGCACCCTTATTTCTCGAGAAATAAGGGTGCCGTGGATCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175363
VALIDATED
PPHLN1 MISSION shRNA Lentiviral Transduction Particles
periphilin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-521s21c1
Sequence:CCGGCAATTCGTGGAAGAGGTAAAGCTCGAGCTTTACCTCTTCCACGAATTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-1112s1c1
Sequence:CCGGCCTTGGATTGTGTAAATCCTTCTCGAGAAGGATTTACACAATCCAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-693s1c1
Sequence:CCGGGACGAAAGTAACTTGGCTGAACTCGAGTTCAGCCAAGTTACTTTCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-678s1c1
Sequence:CCGGACACTAGAGAAGTCAGACGAACTCGAGTTCGTCTGACTTCTCTAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-771s1c1
Sequence:CCGGCCCGAGTCAAACACAGTAGATCTCGAGATCTACTGTGTTTGACTCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175363.2-853s1c1
Sequence:CCGGCCAAAGAGATTGAGCAGGTTTCTCGAGAAACCTGCTCAATCTCTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-971s21c1
Sequence:CCGGGGCAGAACTTACACGAGATAGCTCGAGCTATCTCGTGTAAGTTCTGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-222s21c1
Sequence:CCGGATGGCTAAGAGATGATCATTCCTCGAGGAATGATCATCTCTTAGCCATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175363.3-739s21c1
Sequence:CCGGGGATCCACGGCACCCTTATTTCTCGAGAAATAAGGGTGCCGTGGATCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???