EMAIL THIS PAGE TO A FRIEND

PPIA

peptidylprolyl isomerase A (cyclophilin A)

71 Gene Product Result for
Synonyms: CYPA CYPH
Gene ID:
Human(5478) Summary: This gene encodes a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. The encoded protein is a cyclosporin binding-protein and may play a role in cyclosporin A-mediated immunosuppression. The protein can also interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. Multiple pseudogenes that map to different chromosomes have been reported. [provided by RefSeq, Jul 2008]
Mouse(268373) peptidylprolyl isomerase A
Rat(25518) peptidylprolyl isomerase A (cyclophilin A)
chicken(776282) peptidylprolyl isomerase A (cyclophilin A)
domestic cat(493966) peptidylprolyl isomerase A (cyclophilin A)
dog(608151) peptidylprolyl isomerase A (cyclophilin A)
cow(786614) TRIM5/cyclophilin A fusion protein-like
cow(281418) peptidylprolyl isomerase A (cyclophilin A)
sheep(443258) peptidylprolyl isomerase A (cyclophilin A)
Goat(100860961) peptidylprolyl isomerase A (cyclophilin A)
Domestic Rabbit(100008724) peptidylprolyl isomerase A (cyclophilin A)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021130 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021130 Rosetta Predictions human pricing
NM_203430 Rosetta Predictions human pricing
NM_203431 Rosetta Predictions human pricing
NM_017101 Rosetta Predictions rat pricing
NM_008907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182608 predicted 459
2 SASI_Hs01_00182611 predicted 785
3 SASI_Hs01_00182613 predicted 825
4 SASI_Hs01_00182614 predicted 802
5 SASI_Hs01_00182615 predicted 802
6 SASI_Hs01_00182616 predicted 793
7 SASI_Hs01_00182617 predicted 831
8 SASI_Hs02_00354649 predicted 849
9 SASI_Hs01_00182612 predicted 777
10 SASI_Hs01_00182610 predicted 607
11 SASI_Hs01_00182609 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068575 predicted 596
2 SASI_Hs01_00068576 predicted 745
3 SASI_Hs01_00068577 predicted 742
4 SASI_Hs01_00068578 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099246 predicted 509
2 SASI_Hs01_00099247 predicted 648
3 SASI_Hs01_00099248 predicted 656
4 SASI_Hs01_00099249 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118243 predicted 429
2 SASI_Rn02_00261322 predicted 512
3 SASI_Rn02_00261323 predicted 416
4 SASI_Rn02_00261324 predicted 515
5 SASI_Rn02_00261325 predicted 501
6 SASI_Rn02_00261326 predicted 259
7 SASI_Rn02_00261327 predicted 521
8 SASI_Rn02_00261328 predicted 506
9 SASI_Rn02_00261329 predicted 287
10 SASI_Rn02_00261330 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057692 predicted 227
2 SASI_Mm01_00057700 predicted 224
3 SASI_Mm02_00314927 predicted 228
4 SASI_Mm01_00057691 predicted 295
5 SASI_Mm01_00057693 predicted 362
6 SASI_Mm01_00057694 predicted 331
7 SASI_Mm01_00057695 predicted 415
8 SASI_Mm01_00057696 predicted 430
9 SASI_Mm01_00057697 predicted 290
10 SASI_Mm01_00057698 predicted 516
11 SASI_Mm01_00057699 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008907
VALIDATED
PPIA MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase A (cyclophilin A)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-496s21c1
Sequence:CCGGCCAGCAAGAAGATCACCATTTCTCGAGAAATGGTGATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008907.1-564s21c1
Sequence:CCGGCATCAAACCATTCCTTCTGTACTCGAGTACAGAAGGAATGGTTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-200s21c1
Sequence:CCGGTCACAGAATTATTCCAGGATTCTCGAGAATCCTGGAATAATTCTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-232s21c1
Sequence:CCGGGTGGTGACTTTACACGCCATACTCGAGTATGGCGTGTAAAGTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-564s1c1
Sequence:CCGGCATCAAACCATTCCTTCTGTACTCGAGTACAGAAGGAATGGTTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-200s1c1
Sequence:CCGGTCACAGAATTATTCCAGGATTCTCGAGAATCCTGGAATAATTCTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-496s1c1
Sequence:CCGGCCAGCAAGAAGATCACCATTTCTCGAGAAATGGTGATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-232s1c1
Sequence:CCGGGTGGTGACTTTACACGCCATACTCGAGTATGGCGTGTAAAGTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008907.1-338s1c1
Sequence:CCGGCATGGCAAATGCTGGACCAAACTCGAGTTTGGTCCAGCATTTGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008907
VALIDATED
PPIA MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase A (cyclophilin A)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-496s21c1
Sequence:CCGGCCAGCAAGAAGATCACCATTTCTCGAGAAATGGTGATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008907.1-564s21c1
Sequence:CCGGCATCAAACCATTCCTTCTGTACTCGAGTACAGAAGGAATGGTTTGATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-200s21c1
Sequence:CCGGTCACAGAATTATTCCAGGATTCTCGAGAATCCTGGAATAATTCTGTGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-232s21c1
Sequence:CCGGGTGGTGACTTTACACGCCATACTCGAGTATGGCGTGTAAAGTCACCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-564s1c1
Sequence:CCGGCATCAAACCATTCCTTCTGTACTCGAGTACAGAAGGAATGGTTTGATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-200s1c1
Sequence:CCGGTCACAGAATTATTCCAGGATTCTCGAGAATCCTGGAATAATTCTGTGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-496s1c1
Sequence:CCGGCCAGCAAGAAGATCACCATTTCTCGAGAAATGGTGATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-232s1c1
Sequence:CCGGGTGGTGACTTTACACGCCATACTCGAGTATGGCGTGTAAAGTCACCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008907.1-338s1c1
Sequence:CCGGCATGGCAAATGCTGGACCAAACTCGAGTTTGGTCCAGCATTTGCCATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008907
VALIDATED
PPIA MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase A (cyclophilin A)
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000309763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-496s21c1
Sequence:CCGGCCAGCAAGAAGATCACCATTTCTCGAGAAATGGTGATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008907.1-564s21c1
Sequence:CCGGCATCAAACCATTCCTTCTGTACTCGAGTACAGAAGGAATGGTTTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-200s21c1
Sequence:CCGGTCACAGAATTATTCCAGGATTCTCGAGAATCCTGGAATAATTCTGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008907.1-232s21c1
Sequence:CCGGGTGGTGACTTTACACGCCATACTCGAGTATGGCGTGTAAAGTCACCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-564s1c1
Sequence:CCGGCATCAAACCATTCCTTCTGTACTCGAGTACAGAAGGAATGGTTTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-200s1c1
Sequence:CCGGTCACAGAATTATTCCAGGATTCTCGAGAATCCTGGAATAATTCTGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-496s1c1
Sequence:CCGGCCAGCAAGAAGATCACCATTTCTCGAGAAATGGTGATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008907.1-232s1c1
Sequence:CCGGGTGGTGACTTTACACGCCATACTCGAGTATGGCGTGTAAAGTCACCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008907.1-338s1c1
Sequence:CCGGCATGGCAAATGCTGGACCAAACTCGAGTTTGGTCCAGCATTTGCCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021130
VALIDATED
PPIA MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase A (cyclophilin A)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-221s1c1
Sequence:CCGGGTTCCTGCTTTCACAGAATTACTCGAGTAATTCTGTGAAAGCAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-264s1c1
Sequence:CCGGTGGTGACTTCACACGCCATAACTCGAGTTATGGCGTGTGAAGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-516s1c1
Sequence:CCGGGAATGGCAAGACCAGCAAGAACTCGAGTTCTTGCTGGTCTTGCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-144s1c1
Sequence:CCGGGTTTGCAGACAAGGTCCCAAACTCGAGTTTGGGACCTTGTCTGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-548s1c1
Sequence:CCGGCTGACTGTGGACAACTCGAATCTCGAGATTCGAGTTGTCCACAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021130
VALIDATED
PPIA MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase A (cyclophilin A)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-221s1c1
Sequence:CCGGGTTCCTGCTTTCACAGAATTACTCGAGTAATTCTGTGAAAGCAGGAACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-264s1c1
Sequence:CCGGTGGTGACTTCACACGCCATAACTCGAGTTATGGCGTGTGAAGTCACCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-516s1c1
Sequence:CCGGGAATGGCAAGACCAGCAAGAACTCGAGTTCTTGCTGGTCTTGCCATTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-144s1c1
Sequence:CCGGGTTTGCAGACAAGGTCCCAAACTCGAGTTTGGGACCTTGTCTGCAAACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-548s1c1
Sequence:CCGGCTGACTGTGGACAACTCGAATCTCGAGATTCGAGTTGTCCACAGTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021130
VALIDATED
PPIA MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase A (cyclophilin A)
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000049232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-221s1c1
Sequence:CCGGGTTCCTGCTTTCACAGAATTACTCGAGTAATTCTGTGAAAGCAGGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-264s1c1
Sequence:CCGGTGGTGACTTCACACGCCATAACTCGAGTTATGGCGTGTGAAGTCACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-516s1c1
Sequence:CCGGGAATGGCAAGACCAGCAAGAACTCGAGTTCTTGCTGGTCTTGCCATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-144s1c1
Sequence:CCGGGTTTGCAGACAAGGTCCCAAACTCGAGTTTGGGACCTTGTCTGCAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021130.2-548s1c1
Sequence:CCGGCTGACTGTGGACAACTCGAATCTCGAGATTCGAGTTGTCCACAGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)