EMAIL THIS PAGE TO A FRIEND

PPIAL4C

peptidylprolyl isomerase A (cyclophilin A)-like 4C

4 Gene Product Result for
Synonyms: COAS-2
Species: Human PPIAL4C(653598)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305838 ANTI-PPIAL4A (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001135789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135789 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224371 MISSION® esiRNA esiRNA targeting human PPIAL4C human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135789
PPIAL4C MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase A (cyclophilin A)-like 4C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-572s21c1
Sequence:CCGGTCCTGCTTTCACAGAATTATTCTCGAGAATAATTCTGTGAAAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-547s21c1
Sequence:CCGGAGAGAAAGGATTTCGTTATAACTCGAGTTATAACGAAATCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135789.1-2177s21c1
Sequence:CCGGGAATTTCCACTTCGGAATTAACTCGAGTTAATTCCGAAGTGGAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-897s21c1
Sequence:CCGGCTGACTGTGGACAATTCTAATCTCGAGATTAGAATTGTCCACAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-614s21c1
Sequence:CCGGGGTGACTTCACACGCCATAATCTCGAGATTATGGCGTGTGAAGTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135789
PPIAL4C MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase A (cyclophilin A)-like 4C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-572s21c1
Sequence:CCGGTCCTGCTTTCACAGAATTATTCTCGAGAATAATTCTGTGAAAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-547s21c1
Sequence:CCGGAGAGAAAGGATTTCGTTATAACTCGAGTTATAACGAAATCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135789.1-2177s21c1
Sequence:CCGGGAATTTCCACTTCGGAATTAACTCGAGTTAATTCCGAAGTGGAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-897s21c1
Sequence:CCGGCTGACTGTGGACAATTCTAATCTCGAGATTAGAATTGTCCACAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-614s21c1
Sequence:CCGGGGTGACTTCACACGCCATAATCTCGAGATTATGGCGTGTGAAGTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135789
PPIAL4C MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase A (cyclophilin A)-like 4C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-572s21c1
Sequence:CCGGTCCTGCTTTCACAGAATTATTCTCGAGAATAATTCTGTGAAAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-547s21c1
Sequence:CCGGAGAGAAAGGATTTCGTTATAACTCGAGTTATAACGAAATCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135789.1-2177s21c1
Sequence:CCGGGAATTTCCACTTCGGAATTAACTCGAGTTAATTCCGAAGTGGAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-897s21c1
Sequence:CCGGCTGACTGTGGACAATTCTAATCTCGAGATTAGAATTGTCCACAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135789.1-614s21c1
Sequence:CCGGGGTGACTTCACACGCCATAATCTCGAGATTATGGCGTGTGAAGTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)