EMAIL THIS PAGE TO A FRIEND

PPIAL4G

peptidylprolyl isomerase A (cyclophilin A)-like 4G

21 Gene Product Result for
Synonyms: BX284650.5 COAS-2
Species: Human PPIAL4G(644591)
UniProtKB ID: A2BFH1, A1L431
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305960 ANTI-PPIAL4A(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123068 Rosetta Predictions human pricing
XM_927706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327717 predicted 508
2 SASI_Hs02_00327718 predicted 423
3 SASI_Hs02_00327719 predicted 233
4 SASI_Hs02_00327720 predicted 454
5 SASI_Hs02_00327721 predicted 453
6 SASI_Hs02_00327722 predicted 455
7 SASI_Hs02_00327723 predicted 412
8 SASI_Hs02_00327724 predicted 88
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267873 predicted 852
2 SASI_Hs01_00267874 predicted 846
3 SASI_Hs01_00267875 predicted 897
4 SASI_Hs01_00267876 predicted 902
5 SASI_Hs01_00267877 predicted 478
6 SASI_Hs01_00267878 predicted 892
7 SASI_Hs01_00267879 predicted 818
8 SASI_Hs01_00267880 predicted 481
9 SASI_Hs01_00267881 predicted 627
10 SASI_Hs01_00267882 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123068
PPIAL4G MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase A (cyclophilin A)-like 4G
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123068.1-550s21c1
Sequence:CCGGTTTCACCACCAGACCCATTCCCTCGAGGGAATGGGTCTGGTGGTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-158s21c1
Sequence:CCGGGAGAGAAAGGATTTCGTTATACTCGAGTATAACGAAATCCTTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-195s21c1
Sequence:CCGGCAGAATTATTCCAGGGTTTATCTCGAGATAAACCCTGGAATAATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-227s21c1
Sequence:CCGGGTGACTTCACACACCCTAATGCTCGAGCATTAGGGTGTGTGAAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-251s21c1
Sequence:CCGGCCGGTGACAAGTCCATCTATGCTCGAGCATAGATGGACTTGTCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123068
PPIAL4G MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase A (cyclophilin A)-like 4G
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123068.1-550s21c1
Sequence:CCGGTTTCACCACCAGACCCATTCCCTCGAGGGAATGGGTCTGGTGGTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-158s21c1
Sequence:CCGGGAGAGAAAGGATTTCGTTATACTCGAGTATAACGAAATCCTTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-195s21c1
Sequence:CCGGCAGAATTATTCCAGGGTTTATCTCGAGATAAACCCTGGAATAATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-227s21c1
Sequence:CCGGGTGACTTCACACACCCTAATGCTCGAGCATTAGGGTGTGTGAAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-251s21c1
Sequence:CCGGCCGGTGACAAGTCCATCTATGCTCGAGCATAGATGGACTTGTCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123068
PPIAL4G MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase A (cyclophilin A)-like 4G
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123068.1-550s21c1
Sequence:CCGGTTTCACCACCAGACCCATTCCCTCGAGGGAATGGGTCTGGTGGTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-158s21c1
Sequence:CCGGGAGAGAAAGGATTTCGTTATACTCGAGTATAACGAAATCCTTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-195s21c1
Sequence:CCGGCAGAATTATTCCAGGGTTTATCTCGAGATAAACCCTGGAATAATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-227s21c1
Sequence:CCGGGTGACTTCACACACCCTAATGCTCGAGCATTAGGGTGTGTGAAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123068.1-251s21c1
Sequence:CCGGCCGGTGACAAGTCCATCTATGCTCGAGCATAGATGGACTTGTCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)