EMAIL THIS PAGE TO A FRIEND

PPIAP31

peptidylprolyl isomerase A (cyclophilin A) pseudogene 31

15 Gene Product Result for
Species: Human PPIAP31(439953)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_495800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495800 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017375 Rosetta Predictions human pricing
XR_019278 Rosetta Predictions human pricing
XR_039333 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00492929 predicted 207
2 SASI_Hs02_00492930 predicted 208
3 SASI_Hs02_00492931 predicted 214
4 SASI_Hs02_00492932 predicted 18
5 SASI_Hs02_00492933 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_019278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00497660 predicted 202
2 SASI_Hs02_00497661 predicted 200
3 SASI_Hs02_00497662 predicted 210
4 SASI_Hs02_00497663 predicted 16
5 SASI_Hs02_00497664 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510516 predicted 201
2 SASI_Hs02_00510517 predicted 201
3 SASI_Hs02_00510518 predicted 207
4 SASI_Hs02_00510519 predicted 16
5 SASI_Hs02_00510520 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495800
PPIAP31 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase A (cyclophilin A) pseudogene 31
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_495800.1-614s1c1
Sequence:CCGGGCTCGCAGTATCCTAGAATCTCTCGAGAGATTCTAGGATACTGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-430s1c1
Sequence:CCGGGCAAAGTGAAAGAAGGCATGACTCGAGTCATGCCTTCTTTCACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-291s1c1
Sequence:CCGGGAAGATGAGAACTTCATCCTACTCGAGTAGGATGAAGTTCTCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-512s1c1
Sequence:CCGGCATTGCTGACTGTGGACAACTCTCGAGAGTTGTCCACAGTCAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-434s1c1
Sequence:CCGGAGTGAAAGAAGGCATGAATATCTCGAGATATTCATGCCTTCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495800
PPIAP31 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase A (cyclophilin A) pseudogene 31
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_495800.1-614s1c1
Sequence:CCGGGCTCGCAGTATCCTAGAATCTCTCGAGAGATTCTAGGATACTGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-430s1c1
Sequence:CCGGGCAAAGTGAAAGAAGGCATGACTCGAGTCATGCCTTCTTTCACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-291s1c1
Sequence:CCGGGAAGATGAGAACTTCATCCTACTCGAGTAGGATGAAGTTCTCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-512s1c1
Sequence:CCGGCATTGCTGACTGTGGACAACTCTCGAGAGTTGTCCACAGTCAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-434s1c1
Sequence:CCGGAGTGAAAGAAGGCATGAATATCTCGAGATATTCATGCCTTCTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495800
PPIAP31 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase A (cyclophilin A) pseudogene 31
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_495800.1-614s1c1
Sequence:CCGGGCTCGCAGTATCCTAGAATCTCTCGAGAGATTCTAGGATACTGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-430s1c1
Sequence:CCGGGCAAAGTGAAAGAAGGCATGACTCGAGTCATGCCTTCTTTCACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-291s1c1
Sequence:CCGGGAAGATGAGAACTTCATCCTACTCGAGTAGGATGAAGTTCTCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-512s1c1
Sequence:CCGGCATTGCTGACTGTGGACAACTCTCGAGAGTTGTCCACAGTCAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495800.1-434s1c1
Sequence:CCGGAGTGAAAGAAGGCATGAATATCTCGAGATATTCATGCCTTCTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)