EMAIL THIS PAGE TO A FRIEND

PPIB

peptidylprolyl isomerase B (cyclophilin B)

53 Gene Product Result for
Synonyms: CYP-S1 CYPB OI9 SCYLP
UniProtKB ID: P23284, A8K534, Q6IBH5, Q9BVK5
Gene ID:
Human(5479) Summary: The protein encoded by this gene is a cyclosporine-binding protein and is mainly located within the endoplasmic reticulum. It is associated with the secretory pathway and released in biological fluids. This protein can bind to cells derived from T- and B-lymphocytes, and may regulate cyclosporine A-mediated immunosuppression. Variants have been identified in this protein that give rise to recessive forms of osteogenesis imperfecta. [provided by RefSeq, Oct 2009]
Mouse(19035) peptidylprolyl isomerase B
Rat(64367) peptidylprolyl isomerase B
Zebrafish(406292) peptidylprolyl isomerase B (cyclophilin B)
dog(478337) peptidylprolyl isomerase B (cyclophilin B)
domestic cat(101087581) peptidylprolyl isomerase B (cyclophilin B)
Horse(100066834) peptidylprolyl isomerase B (cyclophilin B)
chicken(396447) peptidylprolyl isomerase B (cyclophilin B)
cow(281419) peptidylprolyl isomerase B (cyclophilin B)
naked mole-rat(101705437) peptidylprolyl isomerase B (cyclophilin B)
domestic guinea pig(100729148) peptidylprolyl isomerase B (cyclophilin B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110531 MISSION® esiRNA targeting human PPIB human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000942 Rosetta Predictions human pricing
NM_022536 Rosetta Predictions rat pricing
NM_011149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303546 predicted 392
2 SASI_Hs01_00041773 predicted 312
3 SASI_Hs01_00041777 predicted 338
4 SASI_Hs01_00041778 predicted 327
5 SASI_Hs01_00041779 predicted 434
6 SASI_Hs02_00303547 predicted 402
7 SASI_Hs01_00041781 predicted 508
8 SASI_Hs02_00303548 predicted 510
9 SASI_Hs02_00303549 predicted 784
10 SASI_Hs01_00041774 predicted 730
11 SASI_Hs01_00041775 predicted 453
12 SASI_Hs01_00041776 predicted 673
13 SASI_Hs01_00041780 predicted 614
14 SASI_Hs01_00041772 positive 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118404 predicted 444
2 SASI_Rn01_00118405 positive 222
3 SASI_Rn01_00118406 predicted 520
4 SASI_Rn01_00118407 predicted 599
5 SASI_Rn01_00118408 predicted 614
6 SASI_Rn01_00118409 predicted 346
7 SASI_Rn01_00118410 predicted 257
8 SASI_Rn01_00118411 predicted 245
9 SASI_Rn01_00118412 predicted 344
10 SASI_Rn01_00118413 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199547 predicted 209
2 SASI_Mm01_00199548 predicted 265
3 SASI_Mm01_00199549 predicted 226
4 SASI_Mm01_00199550 predicted 269
5 SASI_Mm01_00199552 predicted 441
6 SASI_Mm01_00199553 predicted 673
7 SASI_Mm01_00199554 predicted 618
8 SASI_Mm01_00199555 predicted 226
9 SASI_Mm01_00199556 predicted 447
10 SASI_Mm02_00320009 predicted 267
11 SASI_Mm01_00199551 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000942
VALIDATED
PPIB MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase B (cyclophilin B)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-343s1c1
Sequence:CCGGCCGGGTGATCTTTGGTCTCTTCTCGAGAAGAGACCAAAGATCACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-401s1c1
Sequence:CCGGGCCTTAGCTACAGGAGAGAAACTCGAGTTTCTCTCCTGTAGCTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-622s1c1
Sequence:CCGGGTTCTTCATCACGACAGTCAACTCGAGTTGACTGTCGTGATGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-622s21c1
Sequence:CCGGGTTCTTCATCACGACAGTCAACTCGAGTTGACTGTCGTGATGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-361s1c1
Sequence:CCGGCTTCGGAAAGACTGTTCCAAACTCGAGTTTGGAACAGTCTTTCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-292s21c1
Sequence:CCGGAGTCACCGTCAAGGTGTATTTCTCGAGAAATACACCTTGACGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-343s21c1
Sequence:CCGGCCGGGTGATCTTTGGTCTCTTCTCGAGAAGAGACCAAAGATCACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-401s21c1
Sequence:CCGGGCCTTAGCTACAGGAGAGAAACTCGAGTTTCTCTCCTGTAGCTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-316s21c1
Sequence:CCGGCCTACGAATTGGAGATGAAGACTCGAGTCTTCATCTCCAATTCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000942
VALIDATED
PPIB MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase B (cyclophilin B)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-343s1c1
Sequence:CCGGCCGGGTGATCTTTGGTCTCTTCTCGAGAAGAGACCAAAGATCACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-401s1c1
Sequence:CCGGGCCTTAGCTACAGGAGAGAAACTCGAGTTTCTCTCCTGTAGCTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-622s1c1
Sequence:CCGGGTTCTTCATCACGACAGTCAACTCGAGTTGACTGTCGTGATGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-622s21c1
Sequence:CCGGGTTCTTCATCACGACAGTCAACTCGAGTTGACTGTCGTGATGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-361s1c1
Sequence:CCGGCTTCGGAAAGACTGTTCCAAACTCGAGTTTGGAACAGTCTTTCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-292s21c1
Sequence:CCGGAGTCACCGTCAAGGTGTATTTCTCGAGAAATACACCTTGACGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-343s21c1
Sequence:CCGGCCGGGTGATCTTTGGTCTCTTCTCGAGAAGAGACCAAAGATCACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-401s21c1
Sequence:CCGGGCCTTAGCTACAGGAGAGAAACTCGAGTTTCTCTCCTGTAGCTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-316s21c1
Sequence:CCGGCCTACGAATTGGAGATGAAGACTCGAGTCTTCATCTCCAATTCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000942
VALIDATED
PPIB MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase B (cyclophilin B)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-343s1c1
Sequence:CCGGCCGGGTGATCTTTGGTCTCTTCTCGAGAAGAGACCAAAGATCACCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-401s1c1
Sequence:CCGGGCCTTAGCTACAGGAGAGAAACTCGAGTTTCTCTCCTGTAGCTAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-622s1c1
Sequence:CCGGGTTCTTCATCACGACAGTCAACTCGAGTTGACTGTCGTGATGAAGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-622s21c1
Sequence:CCGGGTTCTTCATCACGACAGTCAACTCGAGTTGACTGTCGTGATGAAGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000942.4-361s1c1
Sequence:CCGGCTTCGGAAAGACTGTTCCAAACTCGAGTTTGGAACAGTCTTTCCGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-292s21c1
Sequence:CCGGAGTCACCGTCAAGGTGTATTTCTCGAGAAATACACCTTGACGGTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-343s21c1
Sequence:CCGGCCGGGTGATCTTTGGTCTCTTCTCGAGAAGAGACCAAAGATCACCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-401s21c1
Sequence:CCGGGCCTTAGCTACAGGAGAGAAACTCGAGTTTCTCTCCTGTAGCTAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000942.4-316s21c1
Sequence:CCGGCCTACGAATTGGAGATGAAGACTCGAGTCTTCATCTCCAATTCGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011149
VALIDATED
PPIB MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase B (cyclophilin B)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-266s1c1
Sequence:CCGGGTCACAGTCAAGGTATACTTTCTCGAGAAAGTATACCTTGACTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-367s21c1
Sequence:CCGGCAGCAAGTTCCATCGTGTCATCTCGAGATGACACGATGGAACTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011149.1-810s1c1
Sequence:CCGGCATCCCTCTAAGCAGCTGTCTCTCGAGAGACAGCTGCTTAGAGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-718s1c1
Sequence:CCGGGCCACTGAAGGATGTCATCATCTCGAGATGATGACATCCTTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-244s1c1
Sequence:CCGGCGATAAGAAGAAGGGACCTAACTCGAGTTAGGTCCCTTCTTCTTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-317s1c1
Sequence:CCGGCGAGTCGTCTTTGGACTCTTTCTCGAGAAAGAGTCCAAAGACGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-435s21c1
Sequence:CCGGCAGGAGGAAAGAGCATCTATGCTCGAGCATAGATGCTCTTTCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-673s21c1
Sequence:CCGGGCCACTGAAGGATGTCATCATCTCGAGATGATGACATCCTTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-765s21c1
Sequence:CCGGCATCCCTCTAAGCAGCTGTCTCTCGAGAGACAGCTGCTTAGAGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-221s21c1
Sequence:CCGGGTCACAGTCAAGGTATACTTTCTCGAGAAAGTATACCTTGACTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011149
VALIDATED
PPIB MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase B (cyclophilin B)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-266s1c1
Sequence:CCGGGTCACAGTCAAGGTATACTTTCTCGAGAAAGTATACCTTGACTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-367s21c1
Sequence:CCGGCAGCAAGTTCCATCGTGTCATCTCGAGATGACACGATGGAACTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011149.1-810s1c1
Sequence:CCGGCATCCCTCTAAGCAGCTGTCTCTCGAGAGACAGCTGCTTAGAGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-718s1c1
Sequence:CCGGGCCACTGAAGGATGTCATCATCTCGAGATGATGACATCCTTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-244s1c1
Sequence:CCGGCGATAAGAAGAAGGGACCTAACTCGAGTTAGGTCCCTTCTTCTTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-317s1c1
Sequence:CCGGCGAGTCGTCTTTGGACTCTTTCTCGAGAAAGAGTCCAAAGACGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-435s21c1
Sequence:CCGGCAGGAGGAAAGAGCATCTATGCTCGAGCATAGATGCTCTTTCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-673s21c1
Sequence:CCGGGCCACTGAAGGATGTCATCATCTCGAGATGATGACATCCTTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-765s21c1
Sequence:CCGGCATCCCTCTAAGCAGCTGTCTCTCGAGAGACAGCTGCTTAGAGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-221s21c1
Sequence:CCGGGTCACAGTCAAGGTATACTTTCTCGAGAAAGTATACCTTGACTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011149
VALIDATED
PPIB MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase B (cyclophilin B)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-266s1c1
Sequence:CCGGGTCACAGTCAAGGTATACTTTCTCGAGAAAGTATACCTTGACTGTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-367s21c1
Sequence:CCGGCAGCAAGTTCCATCGTGTCATCTCGAGATGACACGATGGAACTTGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011149.1-810s1c1
Sequence:CCGGCATCCCTCTAAGCAGCTGTCTCTCGAGAGACAGCTGCTTAGAGGGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-718s1c1
Sequence:CCGGGCCACTGAAGGATGTCATCATCTCGAGATGATGACATCCTTCAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-244s1c1
Sequence:CCGGCGATAAGAAGAAGGGACCTAACTCGAGTTAGGTCCCTTCTTCTTATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011149.1-317s1c1
Sequence:CCGGCGAGTCGTCTTTGGACTCTTTCTCGAGAAAGAGTCCAAAGACGACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-435s21c1
Sequence:CCGGCAGGAGGAAAGAGCATCTATGCTCGAGCATAGATGCTCTTTCCTCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-673s21c1
Sequence:CCGGGCCACTGAAGGATGTCATCATCTCGAGATGATGACATCCTTCAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-765s21c1
Sequence:CCGGCATCCCTCTAAGCAGCTGTCTCTCGAGAGACAGCTGCTTAGAGGGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011149.2-221s21c1
Sequence:CCGGGTCACAGTCAAGGTATACTTTCTCGAGAAAGTATACCTTGACTGTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???