EMAIL THIS PAGE TO A FRIEND

PPIC

peptidylprolyl isomerase C (cyclophilin C)

42 Gene Product Result for
Synonyms: CYPC
UniProtKB ID: P45877, A4LBB5
Gene ID:
Human(5480) Summary: The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase)) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. Similar to other PPIases, this protein can bind immunosuppressant cyclosporin A. [provided by RefSeq, Jul 2008]
Mouse(19038) peptidylprolyl isomerase C
Rat(291463) peptidylprolyl isomerase C
cow(535494) peptidylprolyl isomerase C (cyclophilin C)
sheep(101111017) peptidylprolyl isomerase C (cyclophilin C)
domestic guinea pig(100734754) peptidylprolyl isomerase C (cyclophilin C)
naked mole-rat(101720813) peptidylprolyl isomerase C (cyclophilin C)
Domestic Rabbit(100009379) peptidylprolyl isomerase C (cyclophilin C)
chicken(768427) peptidylprolyl isomerase C (cyclophilin C)
domestic cat(101084255) peptidylprolyl isomerase C (cyclophilin C)
dog(481480) peptidylprolyl isomerase C (cyclophilin C)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000943 Rosetta Predictions human pricing
NM_001004215 Rosetta Predictions rat pricing
NM_008908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179778 predicted 422
2 SASI_Hs01_00179782 predicted 354
3 SASI_Hs01_00179786 predicted 344
4 SASI_Hs02_00303550 predicted 338
5 SASI_Hs02_00303551 predicted 395
6 SASI_Hs02_00303552 predicted 425
7 SASI_Hs01_00179779 predicted 431
8 SASI_Hs01_00179781 predicted 438
9 SASI_Hs01_00179784 predicted 368
10 SASI_Hs01_00179787 predicted 318
11 SASI_Hs01_00179780 predicted 257
12 SASI_Hs01_00179783 predicted 255
13 SASI_Hs01_00179785 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055158 predicted 406
2 SASI_Rn01_00055159 predicted 1045
3 SASI_Rn01_00055160 predicted 588
4 SASI_Rn01_00055161 predicted 405
5 SASI_Rn01_00055162 predicted 419
6 SASI_Rn01_00055163 predicted 1036
7 SASI_Rn01_00055164 predicted 404
8 SASI_Rn01_00055165 predicted 319
9 SASI_Rn01_00055166 predicted 229
10 SASI_Rn01_00055167 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091901 predicted 372
2 SASI_Mm01_00091902 predicted 564
3 SASI_Mm01_00091903 predicted 428
4 SASI_Mm01_00091904 predicted 377
5 SASI_Mm01_00091905 predicted 555
6 SASI_Mm01_00091906 predicted 629
7 SASI_Mm01_00091907 predicted 382
8 SASI_Mm01_00091909 predicted 661
9 SASI_Mm01_00091910 predicted 398
10 SASI_Mm02_00314928 predicted 555
11 SASI_Mm01_00091908 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008908
VALIDATED
PPIC MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase C (cyclophilin C)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-520s21c1
Sequence:CCGGGATGGCAAACACGTTGTATTTCTCGAGAAATACAACGTGTTTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-636s21c1
Sequence:CCGGCAGTGGCAAGATAGATGTGAACTCGAGTTCACATCTATCTTGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-916s21c1
Sequence:CCGGGCCTGGGCTAACAGTAAGTTTCTCGAGAAACTTACTGTTAGCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-382s21c1
Sequence:CCGGAGCATCTATGGTGAGACATTTCTCGAGAAATGTCTCACCATAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-555s21c1
Sequence:CCGGTGGGATGACTGTGGTACATTCCTCGAGGAATGTACCACAGTCATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-916s1c1
Sequence:CCGGGCCTGGGCTAACAGTAAGTTTCTCGAGAAACTTACTGTTAGCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-520s1c1
Sequence:CCGGGATGGCAAACACGTTGTATTTCTCGAGAAATACAACGTGTTTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008908.1-208s1c1
Sequence:CCGGAGAATTGTGATTGGCCTCTTTCTCGAGAAAGAGGCCAATCACAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-636s1c1
Sequence:CCGGCAGTGGCAAGATAGATGTGAACTCGAGTTCACATCTATCTTGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-627s1c1
Sequence:CCGGCATCGTCAACAGTGGCAAGATCTCGAGATCTTGCCACTGTTGACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008908
VALIDATED
PPIC MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase C (cyclophilin C)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-520s21c1
Sequence:CCGGGATGGCAAACACGTTGTATTTCTCGAGAAATACAACGTGTTTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-636s21c1
Sequence:CCGGCAGTGGCAAGATAGATGTGAACTCGAGTTCACATCTATCTTGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-916s21c1
Sequence:CCGGGCCTGGGCTAACAGTAAGTTTCTCGAGAAACTTACTGTTAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-382s21c1
Sequence:CCGGAGCATCTATGGTGAGACATTTCTCGAGAAATGTCTCACCATAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-555s21c1
Sequence:CCGGTGGGATGACTGTGGTACATTCCTCGAGGAATGTACCACAGTCATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-916s1c1
Sequence:CCGGGCCTGGGCTAACAGTAAGTTTCTCGAGAAACTTACTGTTAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-520s1c1
Sequence:CCGGGATGGCAAACACGTTGTATTTCTCGAGAAATACAACGTGTTTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008908.1-208s1c1
Sequence:CCGGAGAATTGTGATTGGCCTCTTTCTCGAGAAAGAGGCCAATCACAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-636s1c1
Sequence:CCGGCAGTGGCAAGATAGATGTGAACTCGAGTTCACATCTATCTTGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-627s1c1
Sequence:CCGGCATCGTCAACAGTGGCAAGATCTCGAGATCTTGCCACTGTTGACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008908
VALIDATED
PPIC MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase C (cyclophilin C)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-520s21c1
Sequence:CCGGGATGGCAAACACGTTGTATTTCTCGAGAAATACAACGTGTTTGCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-636s21c1
Sequence:CCGGCAGTGGCAAGATAGATGTGAACTCGAGTTCACATCTATCTTGCCACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-916s21c1
Sequence:CCGGGCCTGGGCTAACAGTAAGTTTCTCGAGAAACTTACTGTTAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-382s21c1
Sequence:CCGGAGCATCTATGGTGAGACATTTCTCGAGAAATGTCTCACCATAGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008908.4-555s21c1
Sequence:CCGGTGGGATGACTGTGGTACATTCCTCGAGGAATGTACCACAGTCATCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-916s1c1
Sequence:CCGGGCCTGGGCTAACAGTAAGTTTCTCGAGAAACTTACTGTTAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-520s1c1
Sequence:CCGGGATGGCAAACACGTTGTATTTCTCGAGAAATACAACGTGTTTGCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008908.1-208s1c1
Sequence:CCGGAGAATTGTGATTGGCCTCTTTCTCGAGAAAGAGGCCAATCACAATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-636s1c1
Sequence:CCGGCAGTGGCAAGATAGATGTGAACTCGAGTTCACATCTATCTTGCCACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008908.1-627s1c1
Sequence:CCGGCATCGTCAACAGTGGCAAGATCTCGAGATCTTGCCACTGTTGACGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000943
VALIDATED
PPIC MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase C (cyclophilin C)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-319s21c1
Sequence:CCGGGCTCTAGCAACAGGAGAGAAACTCGAGTTTCTCTCCTGTTGCTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-540s21c1
Sequence:CCGGGTTCTTTATCACCTTGACCAACTCGAGTTGGTCAAGGTGATAAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-434s21c1
Sequence:CCGGTGAGCATCTATGGTGAGACATCTCGAGATGTCTCACCATAGATGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-678s21c1
Sequence:CCGGCTCGATCATCAACAGTGGCAACTCGAGTTGCCACTGTTGATGATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-232s1c1
Sequence:CCGGGATGTGAGGATTGGAGACAAACTCGAGTTTGTCTCCAATCCTCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-232s21c1
Sequence:CCGGGATGTGAGGATTGGAGACAAACTCGAGTTTGTCTCCAATCCTCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-540s1c1
Sequence:CCGGGTTCTTTATCACCTTGACCAACTCGAGTTGGTCAAGGTGATAAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-434s1c1
Sequence:CCGGTGAGCATCTATGGTGAGACATCTCGAGATGTCTCACCATAGATGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-678s1c1
Sequence:CCGGCTCGATCATCAACAGTGGCAACTCGAGTTGCCACTGTTGATGATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-319s1c1
Sequence:CCGGGCTCTAGCAACAGGAGAGAAACTCGAGTTTCTCTCCTGTTGCTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000943
VALIDATED
PPIC MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase C (cyclophilin C)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-319s21c1
Sequence:CCGGGCTCTAGCAACAGGAGAGAAACTCGAGTTTCTCTCCTGTTGCTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-540s21c1
Sequence:CCGGGTTCTTTATCACCTTGACCAACTCGAGTTGGTCAAGGTGATAAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-434s21c1
Sequence:CCGGTGAGCATCTATGGTGAGACATCTCGAGATGTCTCACCATAGATGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-678s21c1
Sequence:CCGGCTCGATCATCAACAGTGGCAACTCGAGTTGCCACTGTTGATGATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-232s1c1
Sequence:CCGGGATGTGAGGATTGGAGACAAACTCGAGTTTGTCTCCAATCCTCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-232s21c1
Sequence:CCGGGATGTGAGGATTGGAGACAAACTCGAGTTTGTCTCCAATCCTCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-540s1c1
Sequence:CCGGGTTCTTTATCACCTTGACCAACTCGAGTTGGTCAAGGTGATAAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-434s1c1
Sequence:CCGGTGAGCATCTATGGTGAGACATCTCGAGATGTCTCACCATAGATGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-678s1c1
Sequence:CCGGCTCGATCATCAACAGTGGCAACTCGAGTTGCCACTGTTGATGATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-319s1c1
Sequence:CCGGGCTCTAGCAACAGGAGAGAAACTCGAGTTTCTCTCCTGTTGCTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000943
VALIDATED
PPIC MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase C (cyclophilin C)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-319s21c1
Sequence:CCGGGCTCTAGCAACAGGAGAGAAACTCGAGTTTCTCTCCTGTTGCTAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-540s21c1
Sequence:CCGGGTTCTTTATCACCTTGACCAACTCGAGTTGGTCAAGGTGATAAAGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-434s21c1
Sequence:CCGGTGAGCATCTATGGTGAGACATCTCGAGATGTCTCACCATAGATGCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-678s21c1
Sequence:CCGGCTCGATCATCAACAGTGGCAACTCGAGTTGCCACTGTTGATGATCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-232s1c1
Sequence:CCGGGATGTGAGGATTGGAGACAAACTCGAGTTTGTCTCCAATCCTCACATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000943.4-232s21c1
Sequence:CCGGGATGTGAGGATTGGAGACAAACTCGAGTTTGTCTCCAATCCTCACATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-540s1c1
Sequence:CCGGGTTCTTTATCACCTTGACCAACTCGAGTTGGTCAAGGTGATAAAGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-434s1c1
Sequence:CCGGTGAGCATCTATGGTGAGACATCTCGAGATGTCTCACCATAGATGCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-678s1c1
Sequence:CCGGCTCGATCATCAACAGTGGCAACTCGAGTTGCCACTGTTGATGATCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000943.4-319s1c1
Sequence:CCGGGCTCTAGCAACAGGAGAGAAACTCGAGTTTCTCTCCTGTTGCTAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)