EMAIL THIS PAGE TO A FRIEND

PPID

peptidylprolyl isomerase D

64 Gene Product Result for
Synonyms: CYP-40 CYPD
UniProtKB ID: Q08752, B2R9V2
Gene ID:
Human(5481) Summary: The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein has been shown to possess PPIase activity and, similar to other family members, can bind to the immunosuppressant cyclosporin A. [provided by RefSeq, Jul 2008]
Mouse(67738) peptidylprolyl isomerase D (cyclophilin D)
Rat(361967) peptidylprolyl isomerase D
Zebrafish(415155) peptidylprolyl isomerase D
domestic cat(101085200) peptidylprolyl isomerase D
dog(475481) peptidylprolyl isomerase D
chicken(428725) peptidylprolyl isomerase D
Domestic Rabbit(100340606) peptidylprolyl isomerase D
naked mole-rat(101716602) peptidylprolyl isomerase D
domestic guinea pig(100729677) peptidylprolyl isomerase D
cow(281420) peptidylprolyl isomerase D
sheep(101106462) peptidylprolyl isomerase D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031931 MISSION® esiRNA esiRNA human PPID (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005038 Rosetta Predictions human pricing
NM_001004279 Rosetta Predictions rat pricing
NM_026352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124287 predicted 620
2 SASI_Hs01_00124288 predicted 873
3 SASI_Hs01_00124289 predicted 630
4 SASI_Hs01_00124290 predicted 438
5 SASI_Hs01_00124292 predicted 1083
6 SASI_Hs01_00124293 predicted 1144
7 SASI_Hs01_00124294 predicted 1144
8 SASI_Hs01_00124295 predicted 453
9 SASI_Hs01_00124296 predicted 874
10 SASI_Hs02_00338835 predicted 1015
11 SASI_Hs01_00124291 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198316 predicted 955
2 SASI_Rn02_00198317 predicted 1027
3 SASI_Rn02_00198318 predicted 943
4 SASI_Rn02_00198319 predicted 1018
5 SASI_Rn01_00084759 predicted 886
6 SASI_Rn02_00198320 predicted 278
7 SASI_Rn01_00084762 predicted 695
8 SASI_Rn02_00198321 predicted 1041
9 SASI_Rn02_00198322 predicted 498
10 SASI_Rn02_00198323 predicted 343
11 SASI_Rn01_00084760 predicted 890
12 SASI_Rn01_00084761 predicted 879
13 SASI_Rn01_00084763 predicted 887
14 SASI_Rn01_00084764 predicted 1094
15 SASI_Rn01_00084765 predicted 877
16 SASI_Rn01_00084766 predicted 1096
17 SASI_Rn01_00084767 predicted 974
18 SASI_Rn01_00084768 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039328 predicted 1205
2 SASI_Mm01_00039332 predicted 853
3 SASI_Mm01_00039329 predicted 1239
4 SASI_Mm01_00039330 predicted 866
5 SASI_Mm01_00039331 predicted 1253
6 SASI_Mm01_00039333 predicted 116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005038
VALIDATED
PPID MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-626s1c1
Sequence:CCGGCCTGCTAAATTGTGCGTTATTCTCGAGAATAACGCACAATTTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-1021s1c1
Sequence:CCGGCCCATCAAATACCAAAGCATTCTCGAGAATGCTTTGGTATTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-884s1c1
Sequence:CCGGGCTGTTATTGAGACAGCAGATCTCGAGATCTGCTGTCTCAATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-728s1c1
Sequence:CCGGCCTGAGGATGCGGATATAGATCTCGAGATCTATATCCGCATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-197s1c1
Sequence:CCGGGTTGGTCGAATTGTCTTAGAACTCGAGTTCTAAGACAATTCGACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-1188s21c1
Sequence:CCGGATAAAGAGAAGGCAGTATATGCTCGAGCATATACTGCCTTCTCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-1293s21c1
Sequence:CCGGTCTATGAATATGATCCCTAATCTCGAGATTAGGGATCATATTCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-626s21c1
Sequence:CCGGCCTGCTAAATTGTGCGTTATTCTCGAGAATAACGCACAATTTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-728s21c1
Sequence:CCGGCCTGAGGATGCGGATATAGATCTCGAGATCTATATCCGCATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-197s21c1
Sequence:CCGGGTTGGTCGAATTGTCTTAGAACTCGAGTTCTAAGACAATTCGACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005038
VALIDATED
PPID MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-626s1c1
Sequence:CCGGCCTGCTAAATTGTGCGTTATTCTCGAGAATAACGCACAATTTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-1021s1c1
Sequence:CCGGCCCATCAAATACCAAAGCATTCTCGAGAATGCTTTGGTATTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-884s1c1
Sequence:CCGGGCTGTTATTGAGACAGCAGATCTCGAGATCTGCTGTCTCAATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-728s1c1
Sequence:CCGGCCTGAGGATGCGGATATAGATCTCGAGATCTATATCCGCATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-197s1c1
Sequence:CCGGGTTGGTCGAATTGTCTTAGAACTCGAGTTCTAAGACAATTCGACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-1188s21c1
Sequence:CCGGATAAAGAGAAGGCAGTATATGCTCGAGCATATACTGCCTTCTCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-1293s21c1
Sequence:CCGGTCTATGAATATGATCCCTAATCTCGAGATTAGGGATCATATTCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-626s21c1
Sequence:CCGGCCTGCTAAATTGTGCGTTATTCTCGAGAATAACGCACAATTTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-728s21c1
Sequence:CCGGCCTGAGGATGCGGATATAGATCTCGAGATCTATATCCGCATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-197s21c1
Sequence:CCGGGTTGGTCGAATTGTCTTAGAACTCGAGTTCTAAGACAATTCGACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005038
VALIDATED
PPID MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-626s1c1
Sequence:CCGGCCTGCTAAATTGTGCGTTATTCTCGAGAATAACGCACAATTTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-1021s1c1
Sequence:CCGGCCCATCAAATACCAAAGCATTCTCGAGAATGCTTTGGTATTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-884s1c1
Sequence:CCGGGCTGTTATTGAGACAGCAGATCTCGAGATCTGCTGTCTCAATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-728s1c1
Sequence:CCGGCCTGAGGATGCGGATATAGATCTCGAGATCTATATCCGCATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005038.2-197s1c1
Sequence:CCGGGTTGGTCGAATTGTCTTAGAACTCGAGTTCTAAGACAATTCGACCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-1188s21c1
Sequence:CCGGATAAAGAGAAGGCAGTATATGCTCGAGCATATACTGCCTTCTCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-1293s21c1
Sequence:CCGGTCTATGAATATGATCCCTAATCTCGAGATTAGGGATCATATTCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-626s21c1
Sequence:CCGGCCTGCTAAATTGTGCGTTATTCTCGAGAATAACGCACAATTTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-728s21c1
Sequence:CCGGCCTGAGGATGCGGATATAGATCTCGAGATCTATATCCGCATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005038.2-197s21c1
Sequence:CCGGGTTGGTCGAATTGTCTTAGAACTCGAGTTCTAAGACAATTCGACCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026352
VALIDATED
PPID MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase D
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026352.2-1635s1c1
Sequence:CCGGCTGATGTAACTGTCACGTTTACTCGAGTAAACGTGACAGTTACATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-856s1c1
Sequence:CCGGGCTGTTATTGAGAAAGCAGATCTCGAGATCTGCTTTCTCAATAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-1117s1c1
Sequence:CCGGGCAGAATTGCTTAAAGTCAAACTCGAGTTTGACTTTAAGCAATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-598s1c1
Sequence:CCGGCCTGCCAAACTCTGTGTTATTCTCGAGAATAACACAGAGTTTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026352.2-368s1c1
Sequence:CCGGGCGAAAGTATTTATGGTGAAACTCGAGTTTCACCATAAATACTTTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-1117s21c1
Sequence:CCGGGCAGAATTGCTTAAAGTCAAACTCGAGTTTGACTTTAAGCAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-598s21c1
Sequence:CCGGCCTGCCAAACTCTGTGTTATTCTCGAGAATAACACAGAGTTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026352.3-1419s21c1
Sequence:CCGGACTCTAACTCTCACTAAATTTCTCGAGAAATTTAGTGAGAGTTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-294s21c1
Sequence:CCGGATGCCCTTTCCACCGAATTATCTCGAGATAATTCGGTGGAAAGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-856s21c1
Sequence:CCGGGCTGTTATTGAGAAAGCAGATCTCGAGATCTGCTTTCTCAATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026352
VALIDATED
PPID MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase D
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026352.2-1635s1c1
Sequence:CCGGCTGATGTAACTGTCACGTTTACTCGAGTAAACGTGACAGTTACATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-856s1c1
Sequence:CCGGGCTGTTATTGAGAAAGCAGATCTCGAGATCTGCTTTCTCAATAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-1117s1c1
Sequence:CCGGGCAGAATTGCTTAAAGTCAAACTCGAGTTTGACTTTAAGCAATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-598s1c1
Sequence:CCGGCCTGCCAAACTCTGTGTTATTCTCGAGAATAACACAGAGTTTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026352.2-368s1c1
Sequence:CCGGGCGAAAGTATTTATGGTGAAACTCGAGTTTCACCATAAATACTTTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-1117s21c1
Sequence:CCGGGCAGAATTGCTTAAAGTCAAACTCGAGTTTGACTTTAAGCAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-598s21c1
Sequence:CCGGCCTGCCAAACTCTGTGTTATTCTCGAGAATAACACAGAGTTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026352.3-1419s21c1
Sequence:CCGGACTCTAACTCTCACTAAATTTCTCGAGAAATTTAGTGAGAGTTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-294s21c1
Sequence:CCGGATGCCCTTTCCACCGAATTATCTCGAGATAATTCGGTGGAAAGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-856s21c1
Sequence:CCGGGCTGTTATTGAGAAAGCAGATCTCGAGATCTGCTTTCTCAATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026352
VALIDATED
PPID MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase D
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026352.2-1635s1c1
Sequence:CCGGCTGATGTAACTGTCACGTTTACTCGAGTAAACGTGACAGTTACATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-856s1c1
Sequence:CCGGGCTGTTATTGAGAAAGCAGATCTCGAGATCTGCTTTCTCAATAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-1117s1c1
Sequence:CCGGGCAGAATTGCTTAAAGTCAAACTCGAGTTTGACTTTAAGCAATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026352.2-598s1c1
Sequence:CCGGCCTGCCAAACTCTGTGTTATTCTCGAGAATAACACAGAGTTTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026352.2-368s1c1
Sequence:CCGGGCGAAAGTATTTATGGTGAAACTCGAGTTTCACCATAAATACTTTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-1117s21c1
Sequence:CCGGGCAGAATTGCTTAAAGTCAAACTCGAGTTTGACTTTAAGCAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-598s21c1
Sequence:CCGGCCTGCCAAACTCTGTGTTATTCTCGAGAATAACACAGAGTTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026352.3-1419s21c1
Sequence:CCGGACTCTAACTCTCACTAAATTTCTCGAGAAATTTAGTGAGAGTTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-294s21c1
Sequence:CCGGATGCCCTTTCCACCGAATTATCTCGAGATAATTCGGTGGAAAGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026352.3-856s21c1
Sequence:CCGGGCTGTTATTGAGAAAGCAGATCTCGAGATCTGCTTTCTCAATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)