EMAIL THIS PAGE TO A FRIEND

PPIE

peptidylprolyl isomerase E (cyclophilin E)

143 Gene Product Result for
Synonyms: CYP-33 CYP33
Gene ID:
Human(10450) Summary: The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein contains a highly conserved cyclophilin (CYP) domain as well as an RNA-binding domain. It was shown to possess PPIase and protein folding activities, and it also exhibits RNA-binding activity. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 1, has been identified. [provided by RefSeq, Aug 2010]
Mouse(56031) peptidylprolyl isomerase E (cyclophilin E)
Rat(298508) peptidylprolyl isomerase E (cyclophilin E)
domestic guinea pig(100718446) peptidylprolyl isomerase E (cyclophilin E)
naked mole-rat(101715585) peptidylprolyl isomerase E (cyclophilin E)
cow(787681) peptidylprolyl isomerase E (cyclophilin E)
sheep(100302350) peptidylprolyl isomerase E (cyclophilin E)
Zebrafish(550373) peptidylprolyl isomerase E (cyclophilin E)
chicken(426061) peptidylprolyl isomerase E (cyclophilin E)
domestic cat(101096497) peptidylprolyl isomerase E (cyclophilin E)
dog(607232) peptidylprolyl isomerase E (cyclophilin E)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006112 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006112 Rosetta Predictions human pricing
NM_203456 Rosetta Predictions human pricing
NM_203457 Rosetta Predictions human pricing
NM_001047868 Rosetta Predictions rat pricing
NM_019489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219358 predicted 449
2 SASI_Hs01_00219359 predicted 634
3 SASI_Hs01_00219360 predicted 531
4 SASI_Hs01_00219361 predicted 287
5 SASI_Hs01_00219362 predicted 363
6 SASI_Hs01_00219363 predicted 450
7 SASI_Hs01_00219364 predicted 580
8 SASI_Hs01_00219365 predicted 574
9 SASI_Hs01_00219366 predicted 546
10 SASI_Hs01_00219367 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088594 predicted 449
2 SASI_Hs01_00088595 predicted 634
3 SASI_Hs01_00088596 predicted 534
4 SASI_Hs01_00088597 predicted 285
5 SASI_Hs01_00088598 predicted 360
6 SASI_Hs01_00088599 predicted 448
7 SASI_Hs01_00088600 predicted 573
8 SASI_Hs01_00088601 predicted 576
9 SASI_Hs01_00088602 predicted 542
10 SASI_Hs01_00088603 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022352 predicted 440
2 SASI_Hs01_00022353 predicted 633
3 SASI_Hs01_00022354 predicted 529
4 SASI_Hs01_00022355 predicted 274
5 SASI_Hs01_00022356 predicted 350
6 SASI_Hs01_00022357 predicted 436
7 SASI_Hs01_00022358 predicted 569
8 SASI_Hs01_00022359 predicted 570
9 SASI_Hs01_00022360 predicted 536
10 SASI_Hs01_00022361 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206347 predicted 262
2 SASI_Rn02_00206348 predicted 530
3 SASI_Rn02_00206349 predicted 358
4 SASI_Rn02_00206350 predicted 234
5 SASI_Rn02_00206351 predicted 228
6 SASI_Rn02_00206352 predicted 327
7 SASI_Rn02_00206353 predicted 448
8 SASI_Rn02_00206354 predicted 480
9 SASI_Rn02_00206355 predicted 508
10 SASI_Rn02_00206356 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167540 predicted 602
2 SASI_Mm01_00167541 predicted 488
3 SASI_Mm01_00167542 predicted 298
4 SASI_Mm01_00167543 predicted 540
5 SASI_Mm01_00167545 predicted 645
6 SASI_Mm01_00167546 predicted 214
7 SASI_Mm01_00167547 predicted 330
8 SASI_Mm01_00167548 predicted 769
9 SASI_Mm01_00167549 predicted 655
10 SASI_Mm02_00324511 predicted 889
11 SASI_Mm01_00167544 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019489
PPIE MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase E (cyclophilin E)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-68s21c1
Sequence:CCGGAGGTTCTTCATGCTGCATTTACTCGAGTAAATGCAGCATGAAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-192s21c1
Sequence:CCGGAGCAGCTATCGACAACATGAACTCGAGTTCATGTTGTCGATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-230s21c1
Sequence:CCGGGACGGACGATTCGTGTCAATTCTCGAGAATTGACACGAATCGTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019489.5-987s21c1
Sequence:CCGGGTAGAGCACAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTGTGCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019489.2-988s1c1
Sequence:CCGGGTAGAGCACAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTGTGCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-69s1c1
Sequence:CCGGAGGTTCTTCATGCTGCATTTACTCGAGTAAATGCAGCATGAAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-231s1c1
Sequence:CCGGGACGGACGATTCGTGTCAATTCTCGAGAATTGACACGAATCGTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-66s1c1
Sequence:CCGGACAAGGTTCTTCATGCTGCATCTCGAGATGCAGCATGAAGAACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-193s1c1
Sequence:CCGGAGCAGCTATCGACAACATGAACTCGAGTTCATGTTGTCGATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019489
PPIE MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase E (cyclophilin E)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-68s21c1
Sequence:CCGGAGGTTCTTCATGCTGCATTTACTCGAGTAAATGCAGCATGAAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-192s21c1
Sequence:CCGGAGCAGCTATCGACAACATGAACTCGAGTTCATGTTGTCGATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-230s21c1
Sequence:CCGGGACGGACGATTCGTGTCAATTCTCGAGAATTGACACGAATCGTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019489.5-987s21c1
Sequence:CCGGGTAGAGCACAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTGTGCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019489.2-988s1c1
Sequence:CCGGGTAGAGCACAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTGTGCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-69s1c1
Sequence:CCGGAGGTTCTTCATGCTGCATTTACTCGAGTAAATGCAGCATGAAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-231s1c1
Sequence:CCGGGACGGACGATTCGTGTCAATTCTCGAGAATTGACACGAATCGTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-66s1c1
Sequence:CCGGACAAGGTTCTTCATGCTGCATCTCGAGATGCAGCATGAAGAACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-193s1c1
Sequence:CCGGAGCAGCTATCGACAACATGAACTCGAGTTCATGTTGTCGATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019489
PPIE MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase E (cyclophilin E)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-68s21c1
Sequence:CCGGAGGTTCTTCATGCTGCATTTACTCGAGTAAATGCAGCATGAAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-192s21c1
Sequence:CCGGAGCAGCTATCGACAACATGAACTCGAGTTCATGTTGTCGATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019489.5-230s21c1
Sequence:CCGGGACGGACGATTCGTGTCAATTCTCGAGAATTGACACGAATCGTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019489.5-987s21c1
Sequence:CCGGGTAGAGCACAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTGTGCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019489.2-988s1c1
Sequence:CCGGGTAGAGCACAAGCCTTTCCTTCTCGAGAAGGAAAGGCTTGTGCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-69s1c1
Sequence:CCGGAGGTTCTTCATGCTGCATTTACTCGAGTAAATGCAGCATGAAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-231s1c1
Sequence:CCGGGACGGACGATTCGTGTCAATTCTCGAGAATTGACACGAATCGTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-66s1c1
Sequence:CCGGACAAGGTTCTTCATGCTGCATCTCGAGATGCAGCATGAAGAACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019489.2-193s1c1
Sequence:CCGGAGCAGCTATCGACAACATGAACTCGAGTTCATGTTGTCGATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006112
VALIDATED
PPIE MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase E (cyclophilin E)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-856s21c1
Sequence:CCGGCCTAGATGTCTTGCGGCAAATCTCGAGATTTGCCGCAAGACATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-264s21c1
Sequence:CCGGGACGTACAATTCGTGTCAATTCTCGAGAATTGACACGAATTGTACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-643s21c1
Sequence:CCGGCGGTGATTTCACAAACCACAACTCGAGTTGTGGTTTGTGAAATCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-227s21c1
Sequence:CCGGGCAGCTATCGACAACATGAATCTCGAGATTCATGTTGTCGATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-856s1c1
Sequence:CCGGCCTAGATGTCTTGCGGCAAATCTCGAGATTTGCCGCAAGACATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-92s21c1
Sequence:CCGGGTGGACGACAAAGTTCTTCATCTCGAGATGAAGAACTTTGTCGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-227s1c1
Sequence:CCGGGCAGCTATCGACAACATGAATCTCGAGATTCATGTTGTCGATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-643s1c1
Sequence:CCGGCGGTGATTTCACAAACCACAACTCGAGTTGTGGTTTGTGAAATCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-264s1c1
Sequence:CCGGGACGTACAATTCGTGTCAATTCTCGAGAATTGACACGAATTGTACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-92s1c1
Sequence:CCGGGTGGACGACAAAGTTCTTCATCTCGAGATGAAGAACTTTGTCGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006112
VALIDATED
PPIE MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase E (cyclophilin E)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-856s21c1
Sequence:CCGGCCTAGATGTCTTGCGGCAAATCTCGAGATTTGCCGCAAGACATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-264s21c1
Sequence:CCGGGACGTACAATTCGTGTCAATTCTCGAGAATTGACACGAATTGTACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-643s21c1
Sequence:CCGGCGGTGATTTCACAAACCACAACTCGAGTTGTGGTTTGTGAAATCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-227s21c1
Sequence:CCGGGCAGCTATCGACAACATGAATCTCGAGATTCATGTTGTCGATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-856s1c1
Sequence:CCGGCCTAGATGTCTTGCGGCAAATCTCGAGATTTGCCGCAAGACATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-92s21c1
Sequence:CCGGGTGGACGACAAAGTTCTTCATCTCGAGATGAAGAACTTTGTCGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-227s1c1
Sequence:CCGGGCAGCTATCGACAACATGAATCTCGAGATTCATGTTGTCGATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-643s1c1
Sequence:CCGGCGGTGATTTCACAAACCACAACTCGAGTTGTGGTTTGTGAAATCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-264s1c1
Sequence:CCGGGACGTACAATTCGTGTCAATTCTCGAGAATTGACACGAATTGTACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-92s1c1
Sequence:CCGGGTGGACGACAAAGTTCTTCATCTCGAGATGAAGAACTTTGTCGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006112
VALIDATED
PPIE MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase E (cyclophilin E)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-856s21c1
Sequence:CCGGCCTAGATGTCTTGCGGCAAATCTCGAGATTTGCCGCAAGACATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-264s21c1
Sequence:CCGGGACGTACAATTCGTGTCAATTCTCGAGAATTGACACGAATTGTACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-643s21c1
Sequence:CCGGCGGTGATTTCACAAACCACAACTCGAGTTGTGGTTTGTGAAATCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-227s21c1
Sequence:CCGGGCAGCTATCGACAACATGAATCTCGAGATTCATGTTGTCGATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-856s1c1
Sequence:CCGGCCTAGATGTCTTGCGGCAAATCTCGAGATTTGCCGCAAGACATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006112.2-92s21c1
Sequence:CCGGGTGGACGACAAAGTTCTTCATCTCGAGATGAAGAACTTTGTCGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-227s1c1
Sequence:CCGGGCAGCTATCGACAACATGAATCTCGAGATTCATGTTGTCGATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-643s1c1
Sequence:CCGGCGGTGATTTCACAAACCACAACTCGAGTTGTGGTTTGTGAAATCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-264s1c1
Sequence:CCGGGACGTACAATTCGTGTCAATTCTCGAGAATTGACACGAATTGTACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006112.2-92s1c1
Sequence:CCGGGTGGACGACAAAGTTCTTCATCTCGAGATGAAGAACTTTGTCGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)