EMAIL THIS PAGE TO A FRIEND

PPIF

peptidylprolyl isomerase F

67 Gene Product Result for
Synonyms: CYP3 CyP-M Cyp-D CypD
UniProtKB ID: P30405, Q5W131
Gene ID:
Human(10105) Summary: The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein is part of the mitochondrial permeability transition pore in the inner mitochondrial membrane. Activation of this pore is thought to be involved in the induction of apoptotic and necrotic cell death. [provided by RefSeq, Jul 2008]
Mouse(105675) peptidylprolyl isomerase F (cyclophilin F)
Rat(282819) peptidylprolyl isomerase F
chicken(423723) peptidylprolyl isomerase F
domestic cat(101099589) peptidylprolyl isomerase F
dog(610502) peptidylprolyl isomerase F
cow(414346) peptidylprolyl isomerase F
sheep(101111516) peptidylprolyl isomerase F
naked mole-rat(101709131) peptidylprolyl isomerase F
domestic guinea pig(100725941) peptidylprolyl isomerase F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22243F Anti-PPIF antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
AV46141 Anti-PPIF antibody produced in rabbit IgG fraction of antiserum rat, canine, mouse, rabbit, horse, bovine, human, rabbit, sheep, guinea pig
western blot pricing
SAB4500035 Anti-PPIF antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA077416 Anti-PPIF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005729 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005729 Rosetta Predictions human pricing
NM_172243 Rosetta Predictions rat pricing
NM_134084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340158 predicted 631
2 SASI_Hs01_00041257 predicted 332
3 SASI_Hs01_00041258 predicted 1074
4 SASI_Hs01_00041260 predicted 1107
5 SASI_Hs01_00041262 predicted 1073
6 SASI_Hs01_00041263 predicted 902
7 SASI_Hs01_00041264 predicted 669
8 SASI_Hs01_00041265 predicted 1103
9 SASI_Hs01_00041266 predicted 589
10 SASI_Hs02_00340159 predicted 647
11 SASI_Hs01_00041259 predicted 1141
12 SASI_Hs01_00041261 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269199 predicted 484
2 SASI_Rn01_00121775 predicted 646
3 SASI_Rn01_00121776 predicted 800
4 SASI_Rn01_00121777 predicted 436
5 SASI_Rn02_00269200 predicted 475
6 SASI_Rn01_00121778 predicted 235
7 SASI_Rn01_00121779 predicted 697
8 SASI_Rn01_00121780 predicted 718
9 SASI_Rn01_00121781 predicted 717
10 SASI_Rn01_00121783 predicted 604
11 SASI_Rn01_00121782 predicted 741
12 SASI_Rn01_00121784 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188909 predicted 509
2 SASI_Mm02_00339310 predicted 630
3 SASI_Mm01_00188910 predicted 680
4 SASI_Mm01_00188911 predicted 523
5 SASI_Mm01_00188912 predicted 743
6 SASI_Mm01_00188913 predicted 563
7 SASI_Mm01_00188914 predicted 628
8 SASI_Mm01_00188915 predicted 638
9 SASI_Mm01_00188916 predicted 702
10 SASI_Mm01_00188917 predicted 289
11 SASI_Mm01_00188918 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134084
PPIF MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase F
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134084.1-710s1c1
Sequence:CCGGGCAGGCATCCATGTCTTGATTCTCGAGAATCAAGACATGGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-518s1c1
Sequence:CCGGGTTCTTTATCTGCACGATAAACTCGAGTTTATCGTGCAGATAAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-638s1c1
Sequence:CCGGGACGTCTAAGAAGATTGTCATCTCGAGATGACAATCTTCTTAGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-576s1c1
Sequence:CCGGCATGTCAAAGAGGGCATGGATCTCGAGATCCATGCCCTCTTTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-517s1c1
Sequence:CCGGAGTTCTTTATCTGCACGATAACTCGAGTTATCGTGCAGATAAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-576s21c1
Sequence:CCGGCATGTCAAAGAGGGCATGGATCTCGAGATCCATGCCCTCTTTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-638s21c1
Sequence:CCGGGACGTCTAAGAAGATTGTCATCTCGAGATGACAATCTTCTTAGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134084.1-710s21c1
Sequence:CCGGGCAGGCATCCATGTCTTGATTCTCGAGAATCAAGACATGGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-517s21c1
Sequence:CCGGAGTTCTTTATCTGCACGATAACTCGAGTTATCGTGCAGATAAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134084
PPIF MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase F
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134084.1-710s1c1
Sequence:CCGGGCAGGCATCCATGTCTTGATTCTCGAGAATCAAGACATGGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-518s1c1
Sequence:CCGGGTTCTTTATCTGCACGATAAACTCGAGTTTATCGTGCAGATAAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-638s1c1
Sequence:CCGGGACGTCTAAGAAGATTGTCATCTCGAGATGACAATCTTCTTAGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-576s1c1
Sequence:CCGGCATGTCAAAGAGGGCATGGATCTCGAGATCCATGCCCTCTTTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-517s1c1
Sequence:CCGGAGTTCTTTATCTGCACGATAACTCGAGTTATCGTGCAGATAAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-576s21c1
Sequence:CCGGCATGTCAAAGAGGGCATGGATCTCGAGATCCATGCCCTCTTTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-638s21c1
Sequence:CCGGGACGTCTAAGAAGATTGTCATCTCGAGATGACAATCTTCTTAGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134084.1-710s21c1
Sequence:CCGGGCAGGCATCCATGTCTTGATTCTCGAGAATCAAGACATGGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-517s21c1
Sequence:CCGGAGTTCTTTATCTGCACGATAACTCGAGTTATCGTGCAGATAAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134084
PPIF MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase F
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134084.1-710s1c1
Sequence:CCGGGCAGGCATCCATGTCTTGATTCTCGAGAATCAAGACATGGATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-518s1c1
Sequence:CCGGGTTCTTTATCTGCACGATAAACTCGAGTTTATCGTGCAGATAAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-638s1c1
Sequence:CCGGGACGTCTAAGAAGATTGTCATCTCGAGATGACAATCTTCTTAGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-576s1c1
Sequence:CCGGCATGTCAAAGAGGGCATGGATCTCGAGATCCATGCCCTCTTTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134084.1-517s1c1
Sequence:CCGGAGTTCTTTATCTGCACGATAACTCGAGTTATCGTGCAGATAAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-576s21c1
Sequence:CCGGCATGTCAAAGAGGGCATGGATCTCGAGATCCATGCCCTCTTTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-638s21c1
Sequence:CCGGGACGTCTAAGAAGATTGTCATCTCGAGATGACAATCTTCTTAGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134084.1-710s21c1
Sequence:CCGGGCAGGCATCCATGTCTTGATTCTCGAGAATCAAGACATGGATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134084.1-517s21c1
Sequence:CCGGAGTTCTTTATCTGCACGATAACTCGAGTTATCGTGCAGATAAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005729
VALIDATED
PPIF MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase F
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-455s1c1
Sequence:CCGGCGCTTTCCTGACGAGAACTTTCTCGAGAAAGTTCTCGTCAGGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-664s1c1
Sequence:CCGGGACATCCAAGAAGATTGTCATCTCGAGATGACAATCTTCTTGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-508s1c1
Sequence:CCGGCATGGCTAATGCTGGTCCTAACTCGAGTTAGGACCAGCATTAGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-648s1c1
Sequence:CCGGGCTCTAAGAGTGGGAGGACATCTCGAGATGTCCTCCCACTCTTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-349s1c1
Sequence:CCGGCGGCTACAAAGGCTCCACCTTCTCGAGAAGGTGGAGCCTTTGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005729.3-1836s21c1
Sequence:CCGGCTGCATAAGGAGGCGATATAGCTCGAGCTATATCGCCTCCTTATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-691s21c1
Sequence:CCGGCTGTGGCCAGTTGAGCTAATCCTCGAGGATTAGCTCAACTGGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-635s21c1
Sequence:CCGGATAGAATCTTTCGGCTCTAAGCTCGAGCTTAGAGCCGAAAGATTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-544s21c1
Sequence:CCGGGTTCTTCATCTGCACCATAAACTCGAGTTTATGGTGCAGATGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-339s21c1
Sequence:CCGGAGAAGGGCTTCGGCTACAAAGCTCGAGCTTTGTAGCCGAAGCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005729
VALIDATED
PPIF MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase F
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-455s1c1
Sequence:CCGGCGCTTTCCTGACGAGAACTTTCTCGAGAAAGTTCTCGTCAGGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-664s1c1
Sequence:CCGGGACATCCAAGAAGATTGTCATCTCGAGATGACAATCTTCTTGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-508s1c1
Sequence:CCGGCATGGCTAATGCTGGTCCTAACTCGAGTTAGGACCAGCATTAGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-648s1c1
Sequence:CCGGGCTCTAAGAGTGGGAGGACATCTCGAGATGTCCTCCCACTCTTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-349s1c1
Sequence:CCGGCGGCTACAAAGGCTCCACCTTCTCGAGAAGGTGGAGCCTTTGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005729.3-1836s21c1
Sequence:CCGGCTGCATAAGGAGGCGATATAGCTCGAGCTATATCGCCTCCTTATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-691s21c1
Sequence:CCGGCTGTGGCCAGTTGAGCTAATCCTCGAGGATTAGCTCAACTGGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-635s21c1
Sequence:CCGGATAGAATCTTTCGGCTCTAAGCTCGAGCTTAGAGCCGAAAGATTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-544s21c1
Sequence:CCGGGTTCTTCATCTGCACCATAAACTCGAGTTTATGGTGCAGATGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-339s21c1
Sequence:CCGGAGAAGGGCTTCGGCTACAAAGCTCGAGCTTTGTAGCCGAAGCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005729
VALIDATED
PPIF MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase F
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-455s1c1
Sequence:CCGGCGCTTTCCTGACGAGAACTTTCTCGAGAAAGTTCTCGTCAGGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-664s1c1
Sequence:CCGGGACATCCAAGAAGATTGTCATCTCGAGATGACAATCTTCTTGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-508s1c1
Sequence:CCGGCATGGCTAATGCTGGTCCTAACTCGAGTTAGGACCAGCATTAGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-648s1c1
Sequence:CCGGGCTCTAAGAGTGGGAGGACATCTCGAGATGTCCTCCCACTCTTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005729.3-349s1c1
Sequence:CCGGCGGCTACAAAGGCTCCACCTTCTCGAGAAGGTGGAGCCTTTGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005729.3-1836s21c1
Sequence:CCGGCTGCATAAGGAGGCGATATAGCTCGAGCTATATCGCCTCCTTATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-691s21c1
Sequence:CCGGCTGTGGCCAGTTGAGCTAATCCTCGAGGATTAGCTCAACTGGCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-635s21c1
Sequence:CCGGATAGAATCTTTCGGCTCTAAGCTCGAGCTTAGAGCCGAAAGATTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-544s21c1
Sequence:CCGGGTTCTTCATCTGCACCATAAACTCGAGTTTATGGTGCAGATGAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005729.3-339s21c1
Sequence:CCGGAGAAGGGCTTCGGCTACAAAGCTCGAGCTTTGTAGCCGAAGCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)