EMAIL THIS PAGE TO A FRIEND

PPIH

peptidylprolyl isomerase H (cyclophilin H)

76 Gene Product Result for
Synonyms: CYP-20 CYPH SnuCyp-20 USA-CYP
UniProtKB ID: O43447
Gene ID:
Human(10465) Summary: The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein is a specific component of the complex that includes pre-mRNA processing factors PRPF3, PRPF4, and PRPF18, as well as U4/U5/U6 tri-snRNP. This protein has been shown to possess PPIase activity and may act as a protein chaperone that mediates the interactions between different proteins inside the spliceosome. [provided by RefSeq, Jul 2008]
Mouse(66101) peptidyl prolyl isomerase H
Rat(366461) peptidylprolyl isomerase H (cyclophilin H)
Zebrafish(494165) peptidylprolyl isomerase H (cyclophilin H)
chicken(419507) peptidylprolyl isomerase H (cyclophilin H)
domestic cat(101093624) peptidylprolyl isomerase H (cyclophilin H)
dog(606899) peptidylprolyl isomerase H (cyclophilin H)
naked mole-rat(101724207) peptidylprolyl isomerase H (cyclophilin H)
domestic guinea pig(100713882) peptidylprolyl isomerase H (cyclophilin H)
cow(513428) peptidylprolyl isomerase H (cyclophilin H)
sheep(101105450) peptidylprolyl isomerase H (cyclophilin H)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006347 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006347 Rosetta Predictions human pricing
XM_001073803 Rosetta Predictions rat pricing
XM_345576 Rosetta Predictions rat pricing
NM_001110129 Rosetta Predictions mouse pricing
NM_001110130 Rosetta Predictions mouse pricing
NM_028677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073853 predicted 199
2 SASI_Hs01_00073854 predicted 457
3 SASI_Hs01_00073856 predicted 313
4 SASI_Hs01_00073857 predicted 525
5 SASI_Hs01_00073858 predicted 266
6 SASI_Hs01_00073859 predicted 408
7 SASI_Hs01_00073860 predicted 201
8 SASI_Hs01_00073861 predicted 503
9 SASI_Hs01_00073862 predicted 310
10 SASI_Hs02_00341384 predicted 400
11 SASI_Hs01_00073855 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344004 predicted 421
2 SASI_Rn02_00344005 predicted 374
3 SASI_Rn02_00344006 predicted 426
4 SASI_Rn02_00344007 predicted 638
5 SASI_Rn02_00344008 predicted 198
6 SASI_Rn02_00344009 predicted 512
7 SASI_Rn02_00344010 predicted 516
8 SASI_Rn02_00344011 predicted 344
9 SASI_Rn02_00344012 predicted 251
10 SASI_Rn02_00344013 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398520 predicted 197
2 SASI_Rn02_00398521 predicted 283
3 SASI_Rn02_00398522 predicted 281
4 SASI_Rn02_00398523 predicted 232
5 SASI_Rn02_00398524 predicted 197
6 SASI_Rn02_00398525 predicted 289
7 SASI_Rn02_00398526 predicted 285
8 SASI_Rn02_00398527 predicted 256
9 SASI_Rn02_00398528 predicted 213
10 SASI_Rn02_00398529 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304646 predicted 211
2 SASI_Mm02_00304647 predicted 211
3 SASI_Mm02_00304648 predicted 207
4 SASI_Mm02_00304649 predicted 246
5 SASI_Mm02_00304650 predicted 230
6 SASI_Mm02_00304651 predicted 231
7 SASI_Mm02_00304652 predicted 238
8 SASI_Mm02_00304653 predicted 210
9 SASI_Mm02_00304654 predicted 293
10 SASI_Mm02_00304655 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304656 predicted 208
2 SASI_Mm02_00304657 predicted 211
3 SASI_Mm02_00304658 predicted 212
4 SASI_Mm02_00304659 predicted 239
5 SASI_Mm02_00304660 predicted 234
6 SASI_Mm02_00304661 predicted 236
7 SASI_Mm02_00304662 predicted 235
8 SASI_Mm02_00304663 predicted 205
9 SASI_Mm02_00304664 predicted 294
10 SASI_Mm02_00304665 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128000 predicted 435
2 SASI_Mm02_00334229 predicted 209
3 SASI_Mm02_00334230 predicted 228
4 SASI_Mm01_00128004 predicted 384
5 SASI_Mm01_00128005 predicted 504
6 SASI_Mm02_00334231 predicted 289
7 SASI_Mm02_00334232 predicted 215
8 SASI_Mm02_00334233 predicted 244
9 SASI_Mm01_00128007 predicted 434
10 SASI_Mm02_00334234 predicted 494
11 SASI_Mm01_00127999 predicted 580
12 SASI_Mm01_00128001 predicted 580
13 SASI_Mm01_00128002 predicted 284
14 SASI_Mm01_00128003 predicted 203
15 SASI_Mm01_00128006 predicted 581
16 SASI_Mm01_00128008 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006347
VALIDATED
PPIH MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase H (cyclophilin H)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-107s1c1
Sequence:CCGGGTGTTCTTTGATGTCAGTATTCTCGAGAATACTGACATCAAAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-518s1c1
Sequence:CCGGGTGATGAGAAAGATTGAGAATCTCGAGATTCTCAATCTTTCTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-146s1c1
Sequence:CCGGCGCATGAAGATCGAGCTCTTTCTCGAGAAAGAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-518s21c1
Sequence:CCGGGTGATGAGAAAGATTGAGAATCTCGAGATTCTCAATCTTTCTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-408s1c1
Sequence:CCGGCGAACAGTGGTCCAAGTACAACTCGAGTTGTACTTGGACCACTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-265s1c1
Sequence:CCGGCCACAGGGTCATAAAGGATTTCTCGAGAAATCCTTTATGACCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-408s21c1
Sequence:CCGGCGAACAGTGGTCCAAGTACAACTCGAGTTGTACTTGGACCACTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-146s21c1
Sequence:CCGGCGCATGAAGATCGAGCTCTTTCTCGAGAAAGAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-107s21c1
Sequence:CCGGGTGTTCTTTGATGTCAGTATTCTCGAGAATACTGACATCAAAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-265s21c1
Sequence:CCGGCCACAGGGTCATAAAGGATTTCTCGAGAAATCCTTTATGACCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006347
VALIDATED
PPIH MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase H (cyclophilin H)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-107s1c1
Sequence:CCGGGTGTTCTTTGATGTCAGTATTCTCGAGAATACTGACATCAAAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-518s1c1
Sequence:CCGGGTGATGAGAAAGATTGAGAATCTCGAGATTCTCAATCTTTCTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-146s1c1
Sequence:CCGGCGCATGAAGATCGAGCTCTTTCTCGAGAAAGAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-518s21c1
Sequence:CCGGGTGATGAGAAAGATTGAGAATCTCGAGATTCTCAATCTTTCTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-408s1c1
Sequence:CCGGCGAACAGTGGTCCAAGTACAACTCGAGTTGTACTTGGACCACTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-265s1c1
Sequence:CCGGCCACAGGGTCATAAAGGATTTCTCGAGAAATCCTTTATGACCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-408s21c1
Sequence:CCGGCGAACAGTGGTCCAAGTACAACTCGAGTTGTACTTGGACCACTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-146s21c1
Sequence:CCGGCGCATGAAGATCGAGCTCTTTCTCGAGAAAGAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-107s21c1
Sequence:CCGGGTGTTCTTTGATGTCAGTATTCTCGAGAATACTGACATCAAAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-265s21c1
Sequence:CCGGCCACAGGGTCATAAAGGATTTCTCGAGAAATCCTTTATGACCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006347
VALIDATED
PPIH MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase H (cyclophilin H)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-107s1c1
Sequence:CCGGGTGTTCTTTGATGTCAGTATTCTCGAGAATACTGACATCAAAGAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-518s1c1
Sequence:CCGGGTGATGAGAAAGATTGAGAATCTCGAGATTCTCAATCTTTCTCATCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-146s1c1
Sequence:CCGGCGCATGAAGATCGAGCTCTTTCTCGAGAAAGAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-518s21c1
Sequence:CCGGGTGATGAGAAAGATTGAGAATCTCGAGATTCTCAATCTTTCTCATCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-408s1c1
Sequence:CCGGCGAACAGTGGTCCAAGTACAACTCGAGTTGTACTTGGACCACTGTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006347.3-265s1c1
Sequence:CCGGCCACAGGGTCATAAAGGATTTCTCGAGAAATCCTTTATGACCCTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-408s21c1
Sequence:CCGGCGAACAGTGGTCCAAGTACAACTCGAGTTGTACTTGGACCACTGTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-146s21c1
Sequence:CCGGCGCATGAAGATCGAGCTCTTTCTCGAGAAAGAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-107s21c1
Sequence:CCGGGTGTTCTTTGATGTCAGTATTCTCGAGAATACTGACATCAAAGAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006347.3-265s21c1
Sequence:CCGGCCACAGGGTCATAAAGGATTTCTCGAGAAATCCTTTATGACCCTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028677
VALIDATED
PPIH MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase H (cyclophilin H)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-81s1c1
Sequence:CCGGCGCATGAAGATCGAGCTATTTCTCGAGAAATAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028677.3-370s1c1
Sequence:CCGGGCCAGTTCTTTATCACGTGTTCTCGAGAACACGTGATAAAGAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028677.3-646s1c1
Sequence:CCGGGCGATCCAGGACCTGGAAGTACTCGAGTACTTCCAGGTCCTGGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-121s1c1
Sequence:CCGGCGGCAGAGAACTTTAGGCAATCTCGAGATTGCCTAAAGTTCTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-443s1c1
Sequence:CCGGCGGACTTCTAGTGATGAGGAACTCGAGTTCCTCATCACTAGAAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028677
VALIDATED
PPIH MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase H (cyclophilin H)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-81s1c1
Sequence:CCGGCGCATGAAGATCGAGCTATTTCTCGAGAAATAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028677.3-370s1c1
Sequence:CCGGGCCAGTTCTTTATCACGTGTTCTCGAGAACACGTGATAAAGAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028677.3-646s1c1
Sequence:CCGGGCGATCCAGGACCTGGAAGTACTCGAGTACTTCCAGGTCCTGGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-121s1c1
Sequence:CCGGCGGCAGAGAACTTTAGGCAATCTCGAGATTGCCTAAAGTTCTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-443s1c1
Sequence:CCGGCGGACTTCTAGTGATGAGGAACTCGAGTTCCTCATCACTAGAAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028677
VALIDATED
PPIH MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase H (cyclophilin H)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-81s1c1
Sequence:CCGGCGCATGAAGATCGAGCTATTTCTCGAGAAATAGCTCGATCTTCATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028677.3-370s1c1
Sequence:CCGGGCCAGTTCTTTATCACGTGTTCTCGAGAACACGTGATAAAGAACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028677.3-646s1c1
Sequence:CCGGGCGATCCAGGACCTGGAAGTACTCGAGTACTTCCAGGTCCTGGATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-121s1c1
Sequence:CCGGCGGCAGAGAACTTTAGGCAATCTCGAGATTGCCTAAAGTTCTCTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028677.3-443s1c1
Sequence:CCGGCGGACTTCTAGTGATGAGGAACTCGAGTTCCTCATCACTAGAAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)