EMAIL THIS PAGE TO A FRIEND

PPIL1

peptidylprolyl isomerase (cyclophilin)-like 1

97 Gene Product Result for
Synonyms: CYPL1 PPIase hCyPX
UniProtKB ID: Q9Y3C6, O15001, Q5TDC9
Gene ID:
Human(51645) Summary: This gene is a member of the cyclophilin family of peptidylprolyl isomerases (PPIases). The cyclophilins are a highly conserved, ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. Based on similarity to other PPIases, this protein could accelerate the folding of proteins and might catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. [provided by RefSeq, Jul 2008]
Mouse(68816) peptidylprolyl isomerase (cyclophilin)-like 1
Rat(309651) peptidylprolyl isomerase (cyclophilin)-like 1
Zebrafish(558042) peptidylprolyl isomerase (cyclophilin)-like 1
dog(474891) peptidylprolyl isomerase (cyclophilin)-like 1
domestic cat(101081469) peptidylprolyl isomerase (cyclophilin)-like 1
cow(508179) peptidylprolyl isomerase (cyclophilin)-like 1
Goat(100860998) peptidylprolyl isomerase (cyclophilin)-like 1
sheep(101121978) peptidylprolyl isomerase (cyclophilin)-like 1
domestic guinea pig(100720723) peptidylprolyl isomerase (cyclophilin)-like 1
naked mole-rat(101709602) peptidylprolyl isomerase (cyclophilin)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016059 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024381 MISSION® esiRNA targeting mouse Ppil1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016059 Rosetta Predictions human pricing
NM_001034188 Rosetta Predictions rat pricing
XM_001069671 Rosetta Predictions rat pricing
NM_026845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101847 predicted 789
2 SASI_Hs01_00101848 predicted 320
3 SASI_Hs01_00101849 predicted 778
4 SASI_Hs01_00101850 predicted 1000
5 SASI_Hs01_00101851 predicted 310
6 SASI_Hs01_00101852 predicted 757
7 SASI_Hs01_00101853 predicted 762
8 SASI_Hs01_00101854 predicted 355
9 SASI_Hs01_00101855 predicted 959
10 SASI_Hs01_00101856 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204022 predicted 528
2 SASI_Rn01_00083610 predicted 268
3 SASI_Rn01_00083611 predicted 930
4 SASI_Rn01_00083612 predicted 326
5 SASI_Rn01_00083613 predicted 941
6 SASI_Rn01_00083614 predicted 404
7 SASI_Rn01_00083615 predicted 850
8 SASI_Rn01_00083616 predicted 956
9 SASI_Rn01_00083617 predicted 221
10 SASI_Rn01_00083618 predicted 306
11 SASI_Rn01_00083619 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328842 predicted 724
2 SASI_Rn02_00328843 predicted 290
3 SASI_Rn02_00328844 predicted 228
4 SASI_Rn02_00328845 predicted 699
5 SASI_Rn02_00328846 predicted 709
6 SASI_Rn02_00328847 predicted 611
7 SASI_Rn02_00328848 predicted 719
8 SASI_Rn02_00328849 predicted 596
9 SASI_Rn02_00328850 predicted 713
10 SASI_Rn02_00328851 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062785 predicted 757
2 SASI_Mm01_00062786 predicted 393
3 SASI_Mm01_00062787 predicted 265
4 SASI_Mm02_00331043 predicted 748
5 SASI_Mm02_00331044 predicted 578
6 SASI_Mm02_00331045 predicted 443
7 SASI_Mm02_00331046 predicted 784
8 SASI_Mm01_00062791 predicted 497
9 SASI_Mm01_00062788 predicted 594
10 SASI_Mm02_00331047 predicted 602
11 SASI_Mm01_00062789 predicted 270
12 SASI_Mm01_00062790 predicted 333
13 SASI_Mm01_00062792 predicted 666
14 SASI_Mm01_00062793 predicted 802
15 SASI_Mm01_00062794 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026845
VALIDATED
PPIL1 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-197s21c1
Sequence:CCGGCAAGTTCCACAGGATCATCAACTCGAGTTGATGATCCTGTGGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026845.4-929s21c1
Sequence:CCGGGATGATAATGTGTAATGATTGCTCGAGCAATCATTACACATTATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-214s21c1
Sequence:CCGGTCAAGGACTTCATGATCCAAGCTCGAGCTTGGATCATGAAGTCCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-507s21c1
Sequence:CCGGGACGACGTGAAGATTCTTAAGCTCGAGCTTAAGAATCTTCACGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-764s1c1
Sequence:CCGGCGTGAGTTCTTCCAGGAATATCTCGAGATATTCCTGGAAGAACTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-286s1c1
Sequence:CCGGCAGTTTGAAGATGAGCTTCATCTCGAGATGAAGCTCATCTTCAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026845.1-409s1c1
Sequence:CCGGCTGGACGGCAAGCATACTATTCTCGAGAATAGTATGCTTGCCGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-182s1c1
Sequence:CCGGGCTACTACAATGGCACCAAGTCTCGAGACTTGGTGCCATTGTAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-264s1c1
Sequence:CCGGTGGCGCATCTATTTATGGCAACTCGAGTTGCCATAAATAGATGCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026845
VALIDATED
PPIL1 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-197s21c1
Sequence:CCGGCAAGTTCCACAGGATCATCAACTCGAGTTGATGATCCTGTGGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026845.4-929s21c1
Sequence:CCGGGATGATAATGTGTAATGATTGCTCGAGCAATCATTACACATTATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-214s21c1
Sequence:CCGGTCAAGGACTTCATGATCCAAGCTCGAGCTTGGATCATGAAGTCCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-507s21c1
Sequence:CCGGGACGACGTGAAGATTCTTAAGCTCGAGCTTAAGAATCTTCACGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-764s1c1
Sequence:CCGGCGTGAGTTCTTCCAGGAATATCTCGAGATATTCCTGGAAGAACTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-286s1c1
Sequence:CCGGCAGTTTGAAGATGAGCTTCATCTCGAGATGAAGCTCATCTTCAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026845.1-409s1c1
Sequence:CCGGCTGGACGGCAAGCATACTATTCTCGAGAATAGTATGCTTGCCGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-182s1c1
Sequence:CCGGGCTACTACAATGGCACCAAGTCTCGAGACTTGGTGCCATTGTAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-264s1c1
Sequence:CCGGTGGCGCATCTATTTATGGCAACTCGAGTTGCCATAAATAGATGCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026845
VALIDATED
PPIL1 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-197s21c1
Sequence:CCGGCAAGTTCCACAGGATCATCAACTCGAGTTGATGATCCTGTGGAACTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000442701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026845.4-929s21c1
Sequence:CCGGGATGATAATGTGTAATGATTGCTCGAGCAATCATTACACATTATCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000454647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-214s21c1
Sequence:CCGGTCAAGGACTTCATGATCCAAGCTCGAGCTTGGATCATGAAGTCCTTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000444912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026845.4-507s21c1
Sequence:CCGGGACGACGTGAAGATTCTTAAGCTCGAGCTTAAGAATCTTCACGTCGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-764s1c1
Sequence:CCGGCGTGAGTTCTTCCAGGAATATCTCGAGATATTCCTGGAAGAACTCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-286s1c1
Sequence:CCGGCAGTTTGAAGATGAGCTTCATCTCGAGATGAAGCTCATCTTCAAACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026845.1-409s1c1
Sequence:CCGGCTGGACGGCAAGCATACTATTCTCGAGAATAGTATGCTTGCCGTCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-182s1c1
Sequence:CCGGGCTACTACAATGGCACCAAGTCTCGAGACTTGGTGCCATTGTAGTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026845.1-264s1c1
Sequence:CCGGTGGCGCATCTATTTATGGCAACTCGAGTTGCCATAAATAGATGCGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016059
PPIL1 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016059.4-811s21c1
Sequence:CCGGTGACATAGAATGACATGTAATCTCGAGATTACATGTCATTCTATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016059.4-999s21c1
Sequence:CCGGTACTACACATGAACCATAATGCTCGAGCATTATGGTTCATGTGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016059.4-713s21c1
Sequence:CCGGTGGACGACGTGAAGATCATTACTCGAGTAATGATCTTCACGTCGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016059.4-617s21c1
Sequence:CCGGTTGACGGCAAACACACCATTTCTCGAGAAATGGTGTGTTTGCCGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016059.x-1178s1c1
Sequence:CCGGGCACGCCCTATTTCAGTCTTTCTCGAGAAAGACTGAAATAGGGCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-380s1c1
Sequence:CCGGCCACAGAATTATCAAAGACTTCTCGAGAAGTCTTTGATAATTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-354s1c1
Sequence:CCGGCGAGGTTACTACAATGGCACACTCGAGTGTGCCATTGTAGTAACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-356s1c1
Sequence:CCGGAGGTTACTACAATGGCACAAACTCGAGTTTGTGCCATTGTAGTAACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-314s1c1
Sequence:CCGGTGCTCCAAAGACCTGTAAGAACTCGAGTTCTTACAGGTCTTTGGAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016059
PPIL1 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016059.4-811s21c1
Sequence:CCGGTGACATAGAATGACATGTAATCTCGAGATTACATGTCATTCTATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016059.4-999s21c1
Sequence:CCGGTACTACACATGAACCATAATGCTCGAGCATTATGGTTCATGTGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016059.4-713s21c1
Sequence:CCGGTGGACGACGTGAAGATCATTACTCGAGTAATGATCTTCACGTCGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016059.4-617s21c1
Sequence:CCGGTTGACGGCAAACACACCATTTCTCGAGAAATGGTGTGTTTGCCGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016059.x-1178s1c1
Sequence:CCGGGCACGCCCTATTTCAGTCTTTCTCGAGAAAGACTGAAATAGGGCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-380s1c1
Sequence:CCGGCCACAGAATTATCAAAGACTTCTCGAGAAGTCTTTGATAATTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-354s1c1
Sequence:CCGGCGAGGTTACTACAATGGCACACTCGAGTGTGCCATTGTAGTAACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-356s1c1
Sequence:CCGGAGGTTACTACAATGGCACAAACTCGAGTTTGTGCCATTGTAGTAACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-314s1c1
Sequence:CCGGTGCTCCAAAGACCTGTAAGAACTCGAGTTCTTACAGGTCTTTGGAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016059
PPIL1 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016059.4-811s21c1
Sequence:CCGGTGACATAGAATGACATGTAATCTCGAGATTACATGTCATTCTATGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016059.4-999s21c1
Sequence:CCGGTACTACACATGAACCATAATGCTCGAGCATTATGGTTCATGTGTAGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016059.4-713s21c1
Sequence:CCGGTGGACGACGTGAAGATCATTACTCGAGTAATGATCTTCACGTCGTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016059.4-617s21c1
Sequence:CCGGTTGACGGCAAACACACCATTTCTCGAGAAATGGTGTGTTTGCCGTCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016059.x-1178s1c1
Sequence:CCGGGCACGCCCTATTTCAGTCTTTCTCGAGAAAGACTGAAATAGGGCGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-380s1c1
Sequence:CCGGCCACAGAATTATCAAAGACTTCTCGAGAAGTCTTTGATAATTCTGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-354s1c1
Sequence:CCGGCGAGGTTACTACAATGGCACACTCGAGTGTGCCATTGTAGTAACCTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-356s1c1
Sequence:CCGGAGGTTACTACAATGGCACAAACTCGAGTTTGTGCCATTGTAGTAACCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016059.x-314s1c1
Sequence:CCGGTGCTCCAAAGACCTGTAAGAACTCGAGTTCTTACAGGTCTTTGGAGCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???