EMAIL THIS PAGE TO A FRIEND

PPIL2

peptidylprolyl isomerase (cyclophilin)-like 2

86 Gene Product Result for
Synonyms: CYC4 CYP60 Cyp-60 UBOX7 hCyP-60
UniProtKB ID: Q13356, Q13357, Q8TAH2, Q9BWR8
Gene ID:
Human(23759) Summary: This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(66053) peptidylprolyl isomerase (cyclophilin)-like 2
Rat(360746) peptidylprolyl isomerase (cyclophilin)-like 2
Zebrafish(393966) peptidylprolyl isomerase (cyclophilin)-like 2
domestic cat(101087105) peptidylprolyl isomerase (cyclophilin)-like 2
dog(477573) peptidylprolyl isomerase (cyclophilin)-like 2
chicken(416775) peptidylprolyl isomerase (cyclophilin)-like 2
naked mole-rat(101705248) peptidylprolyl isomerase (cyclophilin)-like 2
Domestic Rabbit(100344510) peptidylprolyl isomerase (cyclophilin)-like 2
domestic guinea pig(100734019) peptidylprolyl isomerase (cyclophilin)-like 2
cow(511467) peptidylprolyl isomerase (cyclophilin)-like 2
sheep(101115735) peptidylprolyl isomerase (cyclophilin)-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138431 MISSION® esiRNA esiRNA human PPIL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014337 Rosetta Predictions human pricing
NM_148175 Rosetta Predictions human pricing
NM_148176 Rosetta Predictions human pricing
NM_001017383 Rosetta Predictions rat pricing
NM_144954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215437 predicted 1079
2 SASI_Hs02_00345477 predicted 284
3 SASI_Hs01_00215438 predicted 492
4 SASI_Hs01_00215439 predicted 681
5 SASI_Hs01_00215440 predicted 1057
6 SASI_Hs01_00215441 predicted 599
7 SASI_Hs01_00215443 predicted 299
8 SASI_Hs01_00215444 predicted 423
9 SASI_Hs01_00215445 predicted 1228
10 SASI_Hs02_00345478 predicted 242
11 SASI_Hs01_00215442 predicted 378
12 SASI_Hs01_00215446 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123942 predicted 1076
2 SASI_Hs01_00123943 predicted 486
3 SASI_Hs01_00123944 predicted 678
4 SASI_Hs01_00123945 predicted 1061
5 SASI_Hs01_00123946 predicted 595
6 SASI_Hs02_00365565 predicted 2072
7 SASI_Hs02_00365566 predicted 2076
8 SASI_Hs01_00123948 predicted 307
9 SASI_Hs01_00123949 predicted 426
10 SASI_Hs01_00123950 predicted 1226
11 SASI_Hs01_00123947 predicted 335
12 SASI_Hs01_00123951 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039101 predicted 1081
2 SASI_Hs01_00039103 predicted 493
3 SASI_Hs01_00039104 predicted 673
4 SASI_Hs02_00365567 predicted 1059
5 SASI_Hs02_00365568 predicted 1927
6 SASI_Hs02_00365569 predicted 1939
7 SASI_Hs01_00039107 predicted 307
8 SASI_Hs01_00039108 predicted 426
9 SASI_Hs01_00039109 predicted 1225
10 SASI_Hs02_00365570 predicted 2139
11 SASI_Hs01_00039102 predicted 1235
12 SASI_Hs01_00039105 predicted 568
13 SASI_Hs01_00039106 predicted 338
14 SASI_Hs01_00039110 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047877 predicted 527
2 SASI_Rn01_00047878 predicted 823
3 SASI_Rn01_00047879 predicted 602
4 SASI_Rn01_00047880 predicted 562
5 SASI_Rn01_00047881 predicted 1335
6 SASI_Rn01_00047882 predicted 739
7 SASI_Rn02_00202229 predicted 988
8 SASI_Rn01_00047883 predicted 711
9 SASI_Rn01_00047884 predicted 1507
10 SASI_Rn01_00047885 predicted 968
11 SASI_Rn01_00047886 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143424 predicted 209
2 SASI_Mm01_00143425 predicted 270
3 SASI_Mm02_00340478 predicted 596
4 SASI_Mm01_00143428 predicted 1299
5 SASI_Mm02_00340479 predicted 835
6 SASI_Mm01_00143429 predicted 313
7 SASI_Mm01_00143431 predicted 446
8 SASI_Mm01_00143432 predicted 677
9 SASI_Mm01_00143433 predicted 636
10 SASI_Mm02_00340480 predicted 432
11 SASI_Mm01_00143426 predicted 522
12 SASI_Mm01_00143427 predicted 529
13 SASI_Mm01_00143430 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014337
VALIDATED
PPIL2 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-509s1c1
Sequence:CCGGACAGCTAAATATCAAGGCCAACTCGAGTTGGCCTTGATATTTAGCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014337.x-1245s1c1
Sequence:CCGGTCTCAATTCTTCATCACGTTTCTCGAGAAACGTGATGAAGAATTGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014337.x-512s1c1
Sequence:CCGGGCTAAATATCAAGGCCAAGAACTCGAGTTCTTGGCCTTGATATTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-1231s1c1
Sequence:CCGGCCAACAGCAACAGGTCTCAATCTCGAGATTGAGACCTGTTGCTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-1232s1c1
Sequence:CCGGCAACAGCAACAGGTCTCAATTCTCGAGAATTGAGACCTGTTGCTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-922s21c1
Sequence:CCGGATGTGCTGCGCTACCAGTTTGCTCGAGCAAACTGGTAGCGCAGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014337.3-3709s21c1
Sequence:CCGGTCCACTGAGGGCACGATTTAACTCGAGTTAAATCGTGCCCTCAGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-820s21c1
Sequence:CCGGAGCTGAACGCTGCCCACTATTCTCGAGAATAGTGGGCAGCGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-601s21c1
Sequence:GTACCGGCCAATTTGGACAAGTTCAATGCTCGAGCATTGAACTTGTCCAAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-502s21c1
Sequence:CCGGAGGCAGTGGAACAGCTAAATACTCGAGTATTTAGCTGTTCCACTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014337
VALIDATED
PPIL2 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-509s1c1
Sequence:CCGGACAGCTAAATATCAAGGCCAACTCGAGTTGGCCTTGATATTTAGCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014337.x-1245s1c1
Sequence:CCGGTCTCAATTCTTCATCACGTTTCTCGAGAAACGTGATGAAGAATTGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014337.x-512s1c1
Sequence:CCGGGCTAAATATCAAGGCCAAGAACTCGAGTTCTTGGCCTTGATATTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-1231s1c1
Sequence:CCGGCCAACAGCAACAGGTCTCAATCTCGAGATTGAGACCTGTTGCTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-1232s1c1
Sequence:CCGGCAACAGCAACAGGTCTCAATTCTCGAGAATTGAGACCTGTTGCTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-922s21c1
Sequence:CCGGATGTGCTGCGCTACCAGTTTGCTCGAGCAAACTGGTAGCGCAGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014337.3-3709s21c1
Sequence:CCGGTCCACTGAGGGCACGATTTAACTCGAGTTAAATCGTGCCCTCAGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-820s21c1
Sequence:CCGGAGCTGAACGCTGCCCACTATTCTCGAGAATAGTGGGCAGCGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-601s21c1
Sequence:GTACCGGCCAATTTGGACAAGTTCAATGCTCGAGCATTGAACTTGTCCAAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-502s21c1
Sequence:CCGGAGGCAGTGGAACAGCTAAATACTCGAGTATTTAGCTGTTCCACTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014337
VALIDATED
PPIL2 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-509s1c1
Sequence:CCGGACAGCTAAATATCAAGGCCAACTCGAGTTGGCCTTGATATTTAGCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014337.x-1245s1c1
Sequence:CCGGTCTCAATTCTTCATCACGTTTCTCGAGAAACGTGATGAAGAATTGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014337.x-512s1c1
Sequence:CCGGGCTAAATATCAAGGCCAAGAACTCGAGTTCTTGGCCTTGATATTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-1231s1c1
Sequence:CCGGCCAACAGCAACAGGTCTCAATCTCGAGATTGAGACCTGTTGCTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014337.x-1232s1c1
Sequence:CCGGCAACAGCAACAGGTCTCAATTCTCGAGAATTGAGACCTGTTGCTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-922s21c1
Sequence:CCGGATGTGCTGCGCTACCAGTTTGCTCGAGCAAACTGGTAGCGCAGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014337.3-3709s21c1
Sequence:CCGGTCCACTGAGGGCACGATTTAACTCGAGTTAAATCGTGCCCTCAGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-820s21c1
Sequence:CCGGAGCTGAACGCTGCCCACTATTCTCGAGAATAGTGGGCAGCGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-601s21c1
Sequence:GTACCGGCCAATTTGGACAAGTTCAATGCTCGAGCATTGAACTTGTCCAAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014337.3-502s21c1
Sequence:CCGGAGGCAGTGGAACAGCTAAATACTCGAGTATTTAGCTGTTCCACTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144954
VALIDATED
PPIL2 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-216s1c1
Sequence:CCGGCGTCTTTGACTTGCTGAACATCTCGAGATGTTCAGCAAGTCAAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144954.1-1994s1c1
Sequence:CCGGGACAGTAAAGACACTTGGATTCTCGAGAATCCAAGTGTCTTTACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144954.1-435s1c1
Sequence:CCGGGCAGCTAAACATCAAGGCCAACTCGAGTTGGCCTTGATGTTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-604s1c1
Sequence:CCGGGCCAAACAAGACCCATCTTATCTCGAGATAAGATGGGTCTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-1202s1c1
Sequence:CCGGCTTACCTGGATAAGAAGCATACTCGAGTATGCTTCTTATCCAGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144954
VALIDATED
PPIL2 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-216s1c1
Sequence:CCGGCGTCTTTGACTTGCTGAACATCTCGAGATGTTCAGCAAGTCAAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144954.1-1994s1c1
Sequence:CCGGGACAGTAAAGACACTTGGATTCTCGAGAATCCAAGTGTCTTTACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144954.1-435s1c1
Sequence:CCGGGCAGCTAAACATCAAGGCCAACTCGAGTTGGCCTTGATGTTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-604s1c1
Sequence:CCGGGCCAAACAAGACCCATCTTATCTCGAGATAAGATGGGTCTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-1202s1c1
Sequence:CCGGCTTACCTGGATAAGAAGCATACTCGAGTATGCTTCTTATCCAGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144954
VALIDATED
PPIL2 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-216s1c1
Sequence:CCGGCGTCTTTGACTTGCTGAACATCTCGAGATGTTCAGCAAGTCAAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144954.1-1994s1c1
Sequence:CCGGGACAGTAAAGACACTTGGATTCTCGAGAATCCAAGTGTCTTTACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144954.1-435s1c1
Sequence:CCGGGCAGCTAAACATCAAGGCCAACTCGAGTTGGCCTTGATGTTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-604s1c1
Sequence:CCGGGCCAAACAAGACCCATCTTATCTCGAGATAAGATGGGTCTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144954.1-1202s1c1
Sequence:CCGGCTTACCTGGATAAGAAGCATACTCGAGTATGCTTCTTATCCAGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)