EMAIL THIS PAGE TO A FRIEND

PPIL4

peptidylprolyl isomerase (cyclophilin)-like 4

115 Gene Product Result for
Synonyms: HDCME13P
UniProtKB ID: Q8WUA2, B2RD34, Q7Z3Q5
Gene ID:
Human(85313) Summary: This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. [provided by RefSeq, Jul 2008]
Mouse(67418) peptidylprolyl isomerase (cyclophilin)-like 4
Rat(361449) peptidylprolyl isomerase (cyclophilin)-like 4
Zebrafish(554886) peptidylprolyl isomerase (cyclophilin)-like 4
Horse(100064708) peptidylprolyl isomerase (cyclophilin)-like 4
domestic cat(101098955) peptidylprolyl isomerase (cyclophilin)-like 4
dog(484030) peptidylprolyl isomerase (cyclophilin)-like 4
chicken(421625) peptidylprolyl isomerase (cyclophilin)-like 4
naked mole-rat(101697669) peptidylprolyl isomerase (cyclophilin)-like 4
Domestic Rabbit(100341735) peptidylprolyl isomerase (cyclophilin)-like 4
domestic guinea pig(100719028) peptidylprolyl isomerase (cyclophilin)-like 4
cow(535676) peptidylprolyl isomerase (cyclophilin)-like 4
sheep(101122364) peptidylprolyl isomerase (cyclophilin)-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139126 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139126 Rosetta Predictions human pricing
NM_001108457 Rosetta Predictions rat pricing
NM_026141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364140 predicted 401
2 SASI_Hs01_00158305 predicted 475
3 SASI_Hs02_00364141 predicted 1251
4 SASI_Hs01_00158306 predicted 1024
5 SASI_Hs01_00158307 predicted 947
6 SASI_Hs01_00158308 predicted 222
7 SASI_Hs01_00158309 predicted 407
8 SASI_Hs01_00158310 predicted 894
9 SASI_Hs01_00158311 predicted 485
10 SASI_Hs01_00158312 predicted 1085
11 SASI_Hs01_00158304 predicted 1014
12 SASI_Hs01_00158313 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238829 predicted 808
2 SASI_Rn02_00238830 predicted 480
3 SASI_Rn02_00238831 predicted 836
4 SASI_Rn02_00238832 predicted 1012
5 SASI_Rn02_00238833 predicted 1025
6 SASI_Rn02_00238834 predicted 978
7 SASI_Rn02_00238835 predicted 949
8 SASI_Rn02_00238836 predicted 928
9 SASI_Rn02_00238837 predicted 492
10 SASI_Rn02_00238838 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329749 predicted 805
2 SASI_Mm01_00169551 predicted 777
3 SASI_Mm01_00169552 predicted 1036
4 SASI_Mm01_00169553 predicted 1051
5 SASI_Mm01_00169554 predicted 1008
6 SASI_Mm01_00169555 predicted 502
7 SASI_Mm01_00169556 predicted 858
8 SASI_Mm02_00329750 predicted 308
9 SASI_Mm02_00329751 predicted 733
10 SASI_Mm02_00329752 predicted 746
11 SASI_Mm01_00169550 predicted 783
12 SASI_Mm01_00169557 predicted 272
13 SASI_Mm01_00169558 predicted 1449
14 SASI_Mm01_00169559 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026141
VALIDATED
PPIL4 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026141.2-1066s1c1
Sequence:CCGGCCAGCCAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-237s21c1
Sequence:CCGGCCGCGGAGGAGAGTCTATATTCTCGAGAATATAGACTCTCCTCCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026141.2-2960s1c1
Sequence:CCGGCCTCCAATACTTTCCAGACATCTCGAGATGTCTGGAAAGTATTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026141.2-567s1c1
Sequence:CCGGCGAGCCTACAAAGGAACAATTCTCGAGAATTGTTCCTTTGTAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026141.2-727s1c1
Sequence:CCGGGCAGAAATTAAACCTCCAGAACTCGAGTTCTGGAGGTTTAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026141.2-566s1c1
Sequence:CCGGCCGAGCCTACAAAGGAACAATCTCGAGATTGTTCCTTTGTAGGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-1093s21c1
Sequence:CCGGCCAGCCAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-593s21c1
Sequence:CCGGCCGAGCCTACAAAGGAACAATCTCGAGATTGTTCCTTTGTAGGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-837s21c1
Sequence:CCGGCTCAAGATTTGGGCCAATAAGCTCGAGCTTATTGGCCCAAATCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026141.3-1882s21c1
Sequence:CCGGCACTATGAAAGCTCCATATATCTCGAGATATATGGAGCTTTCATAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026141
VALIDATED
PPIL4 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026141.2-1066s1c1
Sequence:CCGGCCAGCCAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-237s21c1
Sequence:CCGGCCGCGGAGGAGAGTCTATATTCTCGAGAATATAGACTCTCCTCCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026141.2-2960s1c1
Sequence:CCGGCCTCCAATACTTTCCAGACATCTCGAGATGTCTGGAAAGTATTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026141.2-567s1c1
Sequence:CCGGCGAGCCTACAAAGGAACAATTCTCGAGAATTGTTCCTTTGTAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026141.2-727s1c1
Sequence:CCGGGCAGAAATTAAACCTCCAGAACTCGAGTTCTGGAGGTTTAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026141.2-566s1c1
Sequence:CCGGCCGAGCCTACAAAGGAACAATCTCGAGATTGTTCCTTTGTAGGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-1093s21c1
Sequence:CCGGCCAGCCAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-593s21c1
Sequence:CCGGCCGAGCCTACAAAGGAACAATCTCGAGATTGTTCCTTTGTAGGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-837s21c1
Sequence:CCGGCTCAAGATTTGGGCCAATAAGCTCGAGCTTATTGGCCCAAATCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026141.3-1882s21c1
Sequence:CCGGCACTATGAAAGCTCCATATATCTCGAGATATATGGAGCTTTCATAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026141
VALIDATED
PPIL4 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026141.2-1066s1c1
Sequence:CCGGCCAGCCAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTGGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000350083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-237s21c1
Sequence:CCGGCCGCGGAGGAGAGTCTATATTCTCGAGAATATAGACTCTCCTCCGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026141.2-2960s1c1
Sequence:CCGGCCTCCAATACTTTCCAGACATCTCGAGATGTCTGGAAAGTATTGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026141.2-567s1c1
Sequence:CCGGCGAGCCTACAAAGGAACAATTCTCGAGAATTGTTCCTTTGTAGGCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026141.2-727s1c1
Sequence:CCGGGCAGAAATTAAACCTCCAGAACTCGAGTTCTGGAGGTTTAATTTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026141.2-566s1c1
Sequence:CCGGCCGAGCCTACAAAGGAACAATCTCGAGATTGTTCCTTTGTAGGCTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-1093s21c1
Sequence:CCGGCCAGCCAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTGGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-593s21c1
Sequence:CCGGCCGAGCCTACAAAGGAACAATCTCGAGATTGTTCCTTTGTAGGCTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000314064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026141.3-837s21c1
Sequence:CCGGCTCAAGATTTGGGCCAATAAGCTCGAGCTTATTGGCCCAAATCTTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000314063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026141.3-1882s21c1
Sequence:CCGGCACTATGAAAGCTCCATATATCTCGAGATATATGGAGCTTTCATAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139126
VALIDATED
PPIL4 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139126.2-1066s1c1
Sequence:CCGGCCACCTAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_139126.2-1197s1c1
Sequence:CCGGCCATCACTGTTCTGAAGAGAACTCGAGTTCTCTTCAGAACAGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139126.2-279s1c1
Sequence:CCGGCCCAAGAATTAAGCACAAGAACTCGAGTTCTTGTGCTTAATTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139126.2-1455s1c1
Sequence:CCGGCCGAAGCAGAAGTCCAAAGAACTCGAGTTCTTTGGACTTCTGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139126.2-727s1c1
Sequence:CCGGGCAGATATTAAACCTCCAGAACTCGAGTTCTGGAGGTTTAATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-1864s21c1
Sequence:GTACCGGATACAGATGTTGTCGACATTTCTCGAGAAATGTCGACAACATCTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-980s21c1
Sequence:CCGGAGTCGGTTGCAAAGGTTAAATCTCGAGATTTAACCTTTGCAACCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-810s21c1
Sequence:CCGGCTCTAGATTTGGGCCAATAAGCTCGAGCTTATTGGCCCAAATCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139126.2-716s21c1
Sequence:CCGGACCTACCTGATGCAGATATTACTCGAGTAATATCTGCATCAGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139126.2-1056s21c1
Sequence:CCGGACAGGATAAACCACCTAATTTCTCGAGAAATTAGGTGGTTTATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139126
VALIDATED
PPIL4 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139126.2-1066s1c1
Sequence:CCGGCCACCTAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_139126.2-1197s1c1
Sequence:CCGGCCATCACTGTTCTGAAGAGAACTCGAGTTCTCTTCAGAACAGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139126.2-279s1c1
Sequence:CCGGCCCAAGAATTAAGCACAAGAACTCGAGTTCTTGTGCTTAATTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139126.2-1455s1c1
Sequence:CCGGCCGAAGCAGAAGTCCAAAGAACTCGAGTTCTTTGGACTTCTGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139126.2-727s1c1
Sequence:CCGGGCAGATATTAAACCTCCAGAACTCGAGTTCTGGAGGTTTAATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-1864s21c1
Sequence:GTACCGGATACAGATGTTGTCGACATTTCTCGAGAAATGTCGACAACATCTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-980s21c1
Sequence:CCGGAGTCGGTTGCAAAGGTTAAATCTCGAGATTTAACCTTTGCAACCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-810s21c1
Sequence:CCGGCTCTAGATTTGGGCCAATAAGCTCGAGCTTATTGGCCCAAATCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139126.2-716s21c1
Sequence:CCGGACCTACCTGATGCAGATATTACTCGAGTAATATCTGCATCAGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139126.2-1056s21c1
Sequence:CCGGACAGGATAAACCACCTAATTTCTCGAGAAATTAGGTGGTTTATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139126
VALIDATED
PPIL4 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139126.2-1066s1c1
Sequence:CCGGCCACCTAATTTGGTTCTGAAACTCGAGTTTCAGAACCAAATTAGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_139126.2-1197s1c1
Sequence:CCGGCCATCACTGTTCTGAAGAGAACTCGAGTTCTCTTCAGAACAGTGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139126.2-279s1c1
Sequence:CCGGCCCAAGAATTAAGCACAAGAACTCGAGTTCTTGTGCTTAATTCTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139126.2-1455s1c1
Sequence:CCGGCCGAAGCAGAAGTCCAAAGAACTCGAGTTCTTTGGACTTCTGCTTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139126.2-727s1c1
Sequence:CCGGGCAGATATTAAACCTCCAGAACTCGAGTTCTGGAGGTTTAATATCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-1864s21c1
Sequence:GTACCGGATACAGATGTTGTCGACATTTCTCGAGAAATGTCGACAACATCTGTATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000229276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-980s21c1
Sequence:CCGGAGTCGGTTGCAAAGGTTAAATCTCGAGATTTAACCTTTGCAACCGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000229275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139126.2-810s21c1
Sequence:CCGGCTCTAGATTTGGGCCAATAAGCTCGAGCTTATTGGCCCAAATCTAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000229274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139126.2-716s21c1
Sequence:CCGGACCTACCTGATGCAGATATTACTCGAGTAATATCTGCATCAGGTAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000229277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139126.2-1056s21c1
Sequence:CCGGACAGGATAAACCACCTAATTTCTCGAGAAATTAGGTGGTTTATCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???