EMAIL THIS PAGE TO A FRIEND

PPIL6

peptidylprolyl isomerase (cyclophilin)-like 6

85 Gene Product Result for
Synonyms: RSPH12 bA425D10.6 dJ919F19.1
UniProtKB ID: Q8IXY8, A9NIU0, A9NIU9
Gene ID:
Mouse(73075) peptidylprolyl isomerase (cyclophilin)-like 6
Rat(685567) peptidylprolyl isomerase (cyclophilin)-like 6
cow(614498) peptidylprolyl isomerase (cyclophilin)-like 6
sheep(101114364) peptidylprolyl isomerase (cyclophilin)-like 6
domestic guinea pig(100730057) peptidylprolyl isomerase (cyclophilin)-like 6
naked mole-rat(101702924) peptidylprolyl isomerase (cyclophilin)-like 6
Zebrafish(553623) peptidylprolyl isomerase (cyclophilin)-like 6
domestic cat(101100470) peptidylprolyl isomerase (cyclophilin)-like 6
dog(612243) peptidylprolyl isomerase (cyclophilin)-like 6
chicken(421764) peptidylprolyl isomerase (cyclophilin)-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111298 Rosetta Predictions human pricing
NM_173672 Rosetta Predictions human pricing
XM_001064326 Rosetta Predictions rat pricing
NM_028430 Rosetta Predictions mouse pricing
XM_891672 Rosetta Predictions mouse pricing
XM_899697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325334 predicted 704
2 SASI_Hs02_00325335 predicted 827
3 SASI_Hs02_00325336 predicted 520
4 SASI_Hs02_00325337 predicted 415
5 SASI_Hs02_00325338 predicted 605
6 SASI_Hs02_00325339 predicted 792
7 SASI_Hs02_00325340 predicted 622
8 SASI_Hs02_00325341 predicted 630
9 SASI_Hs02_00325342 predicted 780
10 SASI_Hs02_00325343 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021966 predicted 803
2 SASI_Hs02_00368598 predicted 929
3 SASI_Hs01_00021967 predicted 614
4 SASI_Hs01_00021968 predicted 510
5 SASI_Hs01_00021970 predicted 698
6 SASI_Hs02_00368599 predicted 886
7 SASI_Hs02_00368600 predicted 718
8 SASI_Hs02_00368601 predicted 722
9 SASI_Hs02_00368602 predicted 871
10 SASI_Hs02_00368603 predicted 898
11 SASI_Hs01_00021964 predicted 766
12 SASI_Hs01_00021965 predicted 247
13 SASI_Hs01_00021969 predicted 453
14 SASI_Hs01_00021971 predicted 340
15 SASI_Hs01_00021972 predicted 389
16 SASI_Hs01_00021973 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310048 predicted 523
2 SASI_Rn02_00310049 predicted 322
3 SASI_Rn02_00310050 predicted 429
4 SASI_Rn02_00310051 predicted 427
5 SASI_Rn02_00310052 predicted 485
6 SASI_Rn02_00310053 predicted 329
7 SASI_Rn02_00310054 predicted 244
8 SASI_Rn02_00310055 predicted 435
9 SASI_Rn02_00310056 predicted 235
10 SASI_Rn02_00310057 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333859 predicted 769
2 SASI_Mm02_00333860 predicted 240
3 SASI_Mm02_00333861 predicted 734
4 SASI_Mm02_00333862 predicted 785
5 SASI_Mm02_00333863 predicted 423
6 SASI_Mm02_00333864 predicted 238
7 SASI_Mm02_00333865 predicted 789
8 SASI_Mm02_00333866 predicted 691
9 SASI_Mm02_00333867 predicted 563
10 SASI_Mm02_00333868 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263365 predicted 706
2 SASI_Mm01_00263366 predicted 774
3 SASI_Mm01_00263367 predicted 739
4 SASI_Mm01_00263368 predicted 794
5 SASI_Mm01_00263369 predicted 800
6 SASI_Mm01_00263370 predicted 808
7 SASI_Mm01_00263371 predicted 668
8 SASI_Mm01_00263372 predicted 702
9 SASI_Mm01_00263373 predicted 602
10 SASI_Mm01_00263374 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266514 predicted 351
2 SASI_Mm01_00266515 predicted 244
3 SASI_Mm01_00266516 predicted 220
4 SASI_Mm01_00266517 predicted 286
5 SASI_Mm01_00266518 predicted 303
6 SASI_Mm01_00266519 predicted 223
7 SASI_Mm01_00266520 predicted 299
8 SASI_Mm01_00266521 predicted 284
9 SASI_Mm01_00266522 predicted 295
10 SASI_Mm01_00266523 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173672
PPIL6 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-1306s21c1
Sequence:CCGGTACTTGGAATGGCCAACAAAGCTCGAGCTTTGTTGGCCATTCCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173672.4-1563s21c1
Sequence:CCGGATCAGCTGTTTGTGGATTTAACTCGAGTTAAATCCACAAACAGCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-1428s21c1
Sequence:CCGGGTGCTTAAACAACTAGAATTACTCGAGTAATTCTAGTTGTTTAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-374s1c1
Sequence:CCGGGTGTGGGATATAGTTGACATTCTCGAGAATGTCAACTATATCCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-168s1c1
Sequence:CCGGCCGCTGAGAATCTGAAGAATACTCGAGTATTCTTCAGATTCTCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-209s1c1
Sequence:CCGGGATCCTATATTAGTTCCTCTTCTCGAGAAGAGGAACTAATATAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-774s21c1
Sequence:CCGGGAATTTGCATGGCATCAATATCTCGAGATATTGATGCCATGCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-795s1c1
Sequence:CCGGGCAACGGGTCACAATTCTATACTCGAGTATAGAATTGTGACCCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-703s1c1
Sequence:CCGGGTCGATTTATGGTCCAACATTCTCGAGAATGTTGGACCATAAATCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173672
PPIL6 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-1306s21c1
Sequence:CCGGTACTTGGAATGGCCAACAAAGCTCGAGCTTTGTTGGCCATTCCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173672.4-1563s21c1
Sequence:CCGGATCAGCTGTTTGTGGATTTAACTCGAGTTAAATCCACAAACAGCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-1428s21c1
Sequence:CCGGGTGCTTAAACAACTAGAATTACTCGAGTAATTCTAGTTGTTTAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-374s1c1
Sequence:CCGGGTGTGGGATATAGTTGACATTCTCGAGAATGTCAACTATATCCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-168s1c1
Sequence:CCGGCCGCTGAGAATCTGAAGAATACTCGAGTATTCTTCAGATTCTCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-209s1c1
Sequence:CCGGGATCCTATATTAGTTCCTCTTCTCGAGAAGAGGAACTAATATAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-774s21c1
Sequence:CCGGGAATTTGCATGGCATCAATATCTCGAGATATTGATGCCATGCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-795s1c1
Sequence:CCGGGCAACGGGTCACAATTCTATACTCGAGTATAGAATTGTGACCCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-703s1c1
Sequence:CCGGGTCGATTTATGGTCCAACATTCTCGAGAATGTTGGACCATAAATCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173672
PPIL6 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-1306s21c1
Sequence:CCGGTACTTGGAATGGCCAACAAAGCTCGAGCTTTGTTGGCCATTCCAAGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173672.4-1563s21c1
Sequence:CCGGATCAGCTGTTTGTGGATTTAACTCGAGTTAAATCCACAAACAGCTGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-1428s21c1
Sequence:CCGGGTGCTTAAACAACTAGAATTACTCGAGTAATTCTAGTTGTTTAAGCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-374s1c1
Sequence:CCGGGTGTGGGATATAGTTGACATTCTCGAGAATGTCAACTATATCCCACACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-168s1c1
Sequence:CCGGCCGCTGAGAATCTGAAGAATACTCGAGTATTCTTCAGATTCTCAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-209s1c1
Sequence:CCGGGATCCTATATTAGTTCCTCTTCTCGAGAAGAGGAACTAATATAGGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173672.4-774s21c1
Sequence:CCGGGAATTTGCATGGCATCAATATCTCGAGATATTGATGCCATGCAAATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-795s1c1
Sequence:CCGGGCAACGGGTCACAATTCTATACTCGAGTATAGAATTGTGACCCGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173672.1-703s1c1
Sequence:CCGGGTCGATTTATGGTCCAACATTCTCGAGAATGTTGGACCATAAATCGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028430
PPIL6 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-770s21c1
Sequence:CCGGGAGTTCTTGGAATGGTCAATACTCGAGTATTGACCATTCCAAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-337s21c1
Sequence:CCGGCAACTCCTGGGTAACGCATTTCTCGAGAAATGCGTTACCCAGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-288s21c1
Sequence:CCGGGGGTGAAACCTGGGTCTATTCCTCGAGGAATAGACCCAGGTTTCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-699s21c1
Sequence:CCGGAGACGACGGAGAGTCTATTTACTCGAGTAAATAGACTCTCCGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-242s21c1
Sequence:CCGGAGTTTGCTTGGGATCAGTTTCCTCGAGGAAACTGATCCCAAGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028430
PPIL6 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-770s21c1
Sequence:CCGGGAGTTCTTGGAATGGTCAATACTCGAGTATTGACCATTCCAAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-337s21c1
Sequence:CCGGCAACTCCTGGGTAACGCATTTCTCGAGAAATGCGTTACCCAGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-288s21c1
Sequence:CCGGGGGTGAAACCTGGGTCTATTCCTCGAGGAATAGACCCAGGTTTCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-699s21c1
Sequence:CCGGAGACGACGGAGAGTCTATTTACTCGAGTAAATAGACTCTCCGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-242s21c1
Sequence:CCGGAGTTTGCTTGGGATCAGTTTCCTCGAGGAAACTGATCCCAAGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028430
PPIL6 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-770s21c1
Sequence:CCGGGAGTTCTTGGAATGGTCAATACTCGAGTATTGACCATTCCAAGAACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000255155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-337s21c1
Sequence:CCGGCAACTCCTGGGTAACGCATTTCTCGAGAAATGCGTTACCCAGGAGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000255152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-288s21c1
Sequence:CCGGGGGTGAAACCTGGGTCTATTCCTCGAGGAATAGACCCAGGTTTCACCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000255153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-699s21c1
Sequence:CCGGAGACGACGGAGAGTCTATTTACTCGAGTAAATAGACTCTCCGTCGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000255154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028430.1-242s21c1
Sequence:CCGGAGTTTGCTTGGGATCAGTTTCCTCGAGGAAACTGATCCCAAGCAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???