EMAIL THIS PAGE TO A FRIEND

PPM1A

protein phosphatase, Mg2+/Mn2+ dependent, 1A

176 Gene Product Result for
Synonyms: PP2C-ALPHA PP2CA PP2Calpha
UniProtKB ID: P35813, B5BU11, J3KNM0, O75551
Gene ID:
Human(5494) Summary: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase dephosphorylates, and negatively regulates the activities of, MAP kinases and MAP kinase kinases. It has been shown to inhibit the activation of p38 and JNK kinase cascades induced by environmental stresses. This phosphatase can also dephosphorylate cyclin-dependent kinases, and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to activate the expression of the tumor suppressor gene TP53/p53, which leads to G2/M cell cycle arrest and apoptosis. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(19042) protein phosphatase 1A, magnesium dependent, alpha isoform
Rat(24666) protein phosphatase, Mg2+/Mn2+ dependent, 1A
chicken(423525) protein phosphatase, Mg2+/Mn2+ dependent, 1A
domestic cat(101101571) protein phosphatase, Mg2+/Mn2+ dependent, 1A
dog(480344) protein phosphatase, Mg2+/Mn2+ dependent, 1A
cow(281994) protein phosphatase, Mg2+/Mn2+ dependent, 1A
sheep(101103650) protein phosphatase, Mg2+/Mn2+ dependent, 1A
domestic guinea pig(100734826) protein phosphatase, Mg2+/Mn2+ dependent, 1A
Domestic Rabbit(100009431) protein phosphatase, Mg2+/Mn2+ dependent, 1A
naked mole-rat(101720711) protein phosphatase, Mg2+/Mn2+ dependent, 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
U7129 Urea solution 40 % (w/v) in H2O human, mouse, rat pricing
51457 Urea solution BioUltra, ~8 M in H2O human, mouse, rat pricing
299367 Urea-12C 99.9 atom % 12C human, mouse, rat pricing
A2504 6-Aminocaproic acid ≥99% (titration), powder human, rat pricing
A7824 6-Aminocaproic acid BioUltra, ≥99% human, rat pricing
W381918 L-Arginine 99%, FCC, FG human, rat pricing
A5006 L-Arginine reagent grade, ≥98% human, rat pricing
A8094 L-Arginine from non-animal source, meets EP, USP testing specifications, suitable for cell culture, 98.5-101.0% human, rat pricing
A4474 L-Arginine PharmaGrade, Ajinomoto, EP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
11009 L-Arginine BioUltra, ≥99.5% (NT) human, rat pricing
T0625 Taurine ≥99% human, rat pricing
U0631 Urea BioXtra, pH 7.5-9.5 (20 °C, 5 M in H2O) human, rat pricing
U5378 Urea powder, BioReagent, for molecular biology, suitable for cell culture human, rat pricing
U6504 Urea for electrophoresis human, rat pricing
U4884 Urea meets USP testing specifications human, rat pricing
U4128 Urea BioReagent, suitable for cell culture human, rat pricing
U5128 Urea ACS reagent, 99.0-100.5% human, rat pricing
U1250 Urea ReagentPlus®, ≥99.5%, pellets human, rat pricing
51456 Urea BioUltra, for molecular biology, ≥99.5% (T) human, rat pricing
33247 Urea puriss. p.a., ACS reagent, reag. Ph. Eur., ≥99.5% human, rat pricing
51465 Urea tested according to Ph.Eur. human, rat pricing
05292 Spermidine 0.1 M solution mouse, rat pricing
491160 1,6-Diaminohexane-1,6-13C2 99 atom % 13C rat pricing
487481 1,6-Diaminohexane-15N2 98 atom % 15N rat pricing
A2646 D-Arginine ≥98% (TLC) rat pricing
H11696 Hexamethylenediamine 98% rat pricing
422002 Hexamethylenediamine technical grade, 70% rat pricing
S0266 Spermidine BioReagent, for molecular biology, suitable for cell culture, ≥98% rat pricing
S2626 Spermidine ≥99% (GC) rat pricing
S4139 Spermidine suitable for cell culture, BioReagent rat pricing
85558 Spermidine BioUltra, for molecular biology, ≥99.5% (GC) rat pricing
T8691 Taurine cell culture tested, meets USP testing specifications rat pricing
T4571 Taurine PharmaGrade, Ajinomoto, Manufactured under appropriate GMP controls for pharma or biopharmaceutical production, suitable for cell culture rat pricing
86329 Taurine BioUltra, ≥99.5% (T) rat pricing
86330 Taurine ≥99.0% (T) rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021003 Rosetta Predictions human pricing
NM_177951 Rosetta Predictions human pricing
NM_177952 Rosetta Predictions human pricing
NM_017038 Rosetta Predictions rat pricing
NM_008910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354470 predicted 840
2 SASI_Hs01_00180085 predicted 793
3 SASI_Hs01_00180086 predicted 855
4 SASI_Hs01_00180087 predicted 1067
5 SASI_Hs01_00180088 predicted 1008
6 SASI_Hs01_00180089 predicted 871
7 SASI_Hs01_00180090 predicted 707
8 SASI_Hs01_00180091 predicted 1036
9 SASI_Hs01_00180092 predicted 890
10 SASI_Hs01_00180093 predicted 883
11 SASI_Hs01_00180094 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369432 predicted 946
2 SASI_Hs01_00014854 predicted 892
3 SASI_Hs01_00014855 predicted 954
4 SASI_Hs01_00014856 predicted 1172
5 SASI_Hs01_00014857 predicted 1110
6 SASI_Hs01_00014858 predicted 972
7 SASI_Hs01_00014859 predicted 812
8 SASI_Hs01_00014860 predicted 1139
9 SASI_Hs01_00014861 predicted 988
10 SASI_Hs01_00014862 predicted 984
11 SASI_Hs01_00014863 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369433 predicted 809
2 SASI_Hs01_00165846 predicted 754
3 SASI_Hs01_00165847 predicted 816
4 SASI_Hs01_00165848 predicted 1034
5 SASI_Hs01_00165849 predicted 969
6 SASI_Hs01_00165850 predicted 837
7 SASI_Hs01_00165851 predicted 677
8 SASI_Hs01_00165852 predicted 1000
9 SASI_Hs01_00165853 predicted 855
10 SASI_Hs01_00165854 predicted 853
11 SASI_Hs01_00165855 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061583 predicted 919
2 SASI_Rn01_00061584 predicted 774
3 SASI_Rn01_00061585 predicted 876
4 SASI_Rn02_00261225 predicted 856
5 SASI_Rn01_00061586 predicted 1136
6 SASI_Rn01_00061587 predicted 626
7 SASI_Rn01_00061588 predicted 561
8 SASI_Rn01_00061589 predicted 743
9 SASI_Rn01_00061591 predicted 1064
10 SASI_Rn01_00061592 predicted 445
11 SASI_Rn01_00061590 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173663 predicted 519
2 SASI_Mm01_00173664 predicted 1094
3 SASI_Mm02_00314932 predicted 816
4 SASI_Mm01_00173665 predicted 520
5 SASI_Mm01_00173667 predicted 1165
6 SASI_Mm01_00173668 predicted 354
7 SASI_Mm01_00173670 predicted 829
8 SASI_Mm02_00314933 predicted 706
9 SASI_Mm01_00173671 predicted 738
10 SASI_Mm01_00173672 predicted 985
11 SASI_Mm01_00173666 predicted 1116
12 SASI_Mm01_00173669 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021003
VALIDATED
PPM1A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-503s21c1
Sequence:GTACCGGAGGGTAATGGGTTGCGATATGCTCGAGCATATCGCAACCCATTACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-1528s21c1
Sequence:CCGGGCCGTTTACAATAGACTGAATCTCGAGATTCAGTCTATTGTAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-786s21c1
Sequence:CCGGGAGAGTTATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021003.4-2214s21c1
Sequence:CCGGCCTTCGTTGTTTCCATGAGTACTCGAGTACTCATGGAAACAACGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-606s21c1
Sequence:CCGGGTGGTCATTCTTTGCTGTGTACTCGAGTACACAGCAAAGAATGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-1231s1c1
Sequence:CCGGGCACCCAAAGTATCGCCAGAACTCGAGTTCTGGCGATACTTTGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-1429s1c1
Sequence:CCGGGCCGTTTACAATAGACTGAATCTCGAGATTCAGTCTATTGTAAACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-2115s1c1
Sequence:CCGGCCTTCGTTGTTTCCATGAGTACTCGAGTACTCATGGAAACAACGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-687s1c1
Sequence:CCGGGAGAGTTATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATAACTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-507s1c1
Sequence:CCGGGTGGTCATTCTTTGCTGTGTACTCGAGTACACAGCAAAGAATGACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021003
VALIDATED
PPM1A MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-503s21c1
Sequence:GTACCGGAGGGTAATGGGTTGCGATATGCTCGAGCATATCGCAACCCATTACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-1528s21c1
Sequence:CCGGGCCGTTTACAATAGACTGAATCTCGAGATTCAGTCTATTGTAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-786s21c1
Sequence:CCGGGAGAGTTATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021003.4-2214s21c1
Sequence:CCGGCCTTCGTTGTTTCCATGAGTACTCGAGTACTCATGGAAACAACGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-606s21c1
Sequence:CCGGGTGGTCATTCTTTGCTGTGTACTCGAGTACACAGCAAAGAATGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-1231s1c1
Sequence:CCGGGCACCCAAAGTATCGCCAGAACTCGAGTTCTGGCGATACTTTGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-1429s1c1
Sequence:CCGGGCCGTTTACAATAGACTGAATCTCGAGATTCAGTCTATTGTAAACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-2115s1c1
Sequence:CCGGCCTTCGTTGTTTCCATGAGTACTCGAGTACTCATGGAAACAACGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-687s1c1
Sequence:CCGGGAGAGTTATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATAACTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-507s1c1
Sequence:CCGGGTGGTCATTCTTTGCTGTGTACTCGAGTACACAGCAAAGAATGACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021003
VALIDATED
PPM1A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-503s21c1
Sequence:GTACCGGAGGGTAATGGGTTGCGATATGCTCGAGCATATCGCAACCCATTACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-1528s21c1
Sequence:CCGGGCCGTTTACAATAGACTGAATCTCGAGATTCAGTCTATTGTAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-786s21c1
Sequence:CCGGGAGAGTTATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021003.4-2214s21c1
Sequence:CCGGCCTTCGTTGTTTCCATGAGTACTCGAGTACTCATGGAAACAACGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021003.4-606s21c1
Sequence:CCGGGTGGTCATTCTTTGCTGTGTACTCGAGTACACAGCAAAGAATGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-1231s1c1
Sequence:CCGGGCACCCAAAGTATCGCCAGAACTCGAGTTCTGGCGATACTTTGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-1429s1c1
Sequence:CCGGGCCGTTTACAATAGACTGAATCTCGAGATTCAGTCTATTGTAAACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-2115s1c1
Sequence:CCGGCCTTCGTTGTTTCCATGAGTACTCGAGTACTCATGGAAACAACGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-687s1c1
Sequence:CCGGGAGAGTTATGTCAGAGAAGAACTCGAGTTCTTCTCTGACATAACTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021003.x-507s1c1
Sequence:CCGGGTGGTCATTCTTTGCTGTGTACTCGAGTACACAGCAAAGAATGACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008910
VALIDATED
PPM1A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008910.2-703s21c1
Sequence:CCGGCCCGAAGTCCATGATATTGAACTCGAGTTCAATATCATGGACTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.3-1768s21c1
Sequence:CCGGAGACTTATGTAAGCGTGATTTCTCGAGAAATCACGCTTACATAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.2-1170s21c1
Sequence:CCGGTTCTGCGTCAACCGATGATATCTCGAGATATCATCGGTTGACGCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.2-428s21c1
Sequence:CCGGCAACAGCTGTGGGCGTCTTAACTCGAGTTAAGACGCCCACAGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.3-1384s21c1
Sequence:CCGGAGAGTAGAAGAAATCATAAAGCTCGAGCTTTATGATTTCTTCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008910.2-1111s21c1
Sequence:CCGGCGGAATGTAATTGAAGCCGTTCTCGAGAACGGCTTCAATTACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008910.2-1475s21c1
Sequence:CCGGTTGTACAAAGTGCTCATATTTCTCGAGAAATATGAGCACTTTGTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-1387s1c1
Sequence:CCGGGCGTGATTTCAAACCGTAATTCTCGAGAATTACGGTTTGAAATCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-703s1c1
Sequence:CCGGCCCGAAGTCCATGATATTGAACTCGAGTTCAATATCATGGACTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-1111s1c1
Sequence:CCGGCGGAATGTAATTGAAGCCGTTCTCGAGAACGGCTTCAATTACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008910.2-704s1c1
Sequence:CCGGCCGAAGTCCATGATATTGAAACTCGAGTTTCAATATCATGGACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008910.2-889s1c1
Sequence:CCGGCGAGACAACATGAGTGTGATTCTCGAGAATCACACTCATGTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008910
VALIDATED
PPM1A MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008910.2-703s21c1
Sequence:CCGGCCCGAAGTCCATGATATTGAACTCGAGTTCAATATCATGGACTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.3-1768s21c1
Sequence:CCGGAGACTTATGTAAGCGTGATTTCTCGAGAAATCACGCTTACATAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.2-1170s21c1
Sequence:CCGGTTCTGCGTCAACCGATGATATCTCGAGATATCATCGGTTGACGCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.2-428s21c1
Sequence:CCGGCAACAGCTGTGGGCGTCTTAACTCGAGTTAAGACGCCCACAGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.3-1384s21c1
Sequence:CCGGAGAGTAGAAGAAATCATAAAGCTCGAGCTTTATGATTTCTTCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008910.2-1111s21c1
Sequence:CCGGCGGAATGTAATTGAAGCCGTTCTCGAGAACGGCTTCAATTACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008910.2-1475s21c1
Sequence:CCGGTTGTACAAAGTGCTCATATTTCTCGAGAAATATGAGCACTTTGTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-1387s1c1
Sequence:CCGGGCGTGATTTCAAACCGTAATTCTCGAGAATTACGGTTTGAAATCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-703s1c1
Sequence:CCGGCCCGAAGTCCATGATATTGAACTCGAGTTCAATATCATGGACTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-1111s1c1
Sequence:CCGGCGGAATGTAATTGAAGCCGTTCTCGAGAACGGCTTCAATTACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008910.2-704s1c1
Sequence:CCGGCCGAAGTCCATGATATTGAAACTCGAGTTTCAATATCATGGACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008910.2-889s1c1
Sequence:CCGGCGAGACAACATGAGTGTGATTCTCGAGAATCACACTCATGTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008910
VALIDATED
PPM1A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008910.2-703s21c1
Sequence:CCGGCCCGAAGTCCATGATATTGAACTCGAGTTCAATATCATGGACTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.3-1768s21c1
Sequence:CCGGAGACTTATGTAAGCGTGATTTCTCGAGAAATCACGCTTACATAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.2-1170s21c1
Sequence:CCGGTTCTGCGTCAACCGATGATATCTCGAGATATCATCGGTTGACGCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.2-428s21c1
Sequence:CCGGCAACAGCTGTGGGCGTCTTAACTCGAGTTAAGACGCCCACAGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008910.3-1384s21c1
Sequence:CCGGAGAGTAGAAGAAATCATAAAGCTCGAGCTTTATGATTTCTTCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008910.2-1111s21c1
Sequence:CCGGCGGAATGTAATTGAAGCCGTTCTCGAGAACGGCTTCAATTACATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008910.2-1475s21c1
Sequence:CCGGTTGTACAAAGTGCTCATATTTCTCGAGAAATATGAGCACTTTGTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-1387s1c1
Sequence:CCGGGCGTGATTTCAAACCGTAATTCTCGAGAATTACGGTTTGAAATCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-703s1c1
Sequence:CCGGCCCGAAGTCCATGATATTGAACTCGAGTTCAATATCATGGACTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008910.2-1111s1c1
Sequence:CCGGCGGAATGTAATTGAAGCCGTTCTCGAGAACGGCTTCAATTACATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008910.2-704s1c1
Sequence:CCGGCCGAAGTCCATGATATTGAAACTCGAGTTTCAATATCATGGACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008910.2-889s1c1
Sequence:CCGGCGAGACAACATGAGTGTGATTCTCGAGAATCACACTCATGTTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)