EMAIL THIS PAGE TO A FRIEND

PPM1B

protein phosphatase, Mg2+/Mn2+ dependent, 1B

266 Gene Product Result for
Synonyms: PP2C-beta-X PP2CB PP2CBETA PPC2BETAX
Gene ID:
Human(5495) Summary: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences. [provided by RefSeq, Jul 2008]
Mouse(19043) protein phosphatase 1B, magnesium dependent, beta isoform
Rat(24667) protein phosphatase, Mg2+/Mn2+ dependent, 1B
chicken(421404) protein phosphatase, Mg2+/Mn2+ dependent, 1B
domestic cat(101094170) protein phosphatase, Mg2+/Mn2+ dependent, 1B
Horse(100053585) protein phosphatase, Mg2+/Mn2+ dependent, 1B
dog(474573) protein phosphatase, Mg2+/Mn2+ dependent, 1B
naked mole-rat(101724963) protein phosphatase, Mg2+/Mn2+ dependent, 1B
Domestic Rabbit(100356616) protein phosphatase, Mg2+/Mn2+ dependent, 1B
domestic guinea pig(100719242) protein phosphatase, Mg2+/Mn2+ dependent, 1B
cow(281995) protein phosphatase, Mg2+/Mn2+ dependent, 1B
sheep(101112467) protein phosphatase, Mg2+/Mn2+ dependent, 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033556 Rosetta Predictions human pricing
NM_001033557 Rosetta Predictions human pricing
NM_002706 Rosetta Predictions human pricing
NM_177968 Rosetta Predictions human pricing
NM_177969 Rosetta Predictions human pricing
NM_033096 Rosetta Predictions rat pricing
NM_011151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133010 predicted 638
2 SASI_Hs01_00133011 predicted 1158
3 SASI_Hs01_00133012 predicted 567
4 SASI_Hs01_00133013 predicted 630
5 SASI_Hs01_00133014 predicted 622
6 SASI_Hs01_00133015 predicted 980
7 SASI_Hs01_00133016 predicted 543
8 SASI_Hs01_00133017 predicted 819
9 SASI_Hs01_00133018 predicted 875
10 SASI_Hs01_00133019 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223583 predicted 622
2 SASI_Hs01_00223584 predicted 1577
3 SASI_Hs01_00223585 predicted 1278
4 SASI_Hs01_00223586 predicted 872
5 SASI_Hs01_00223587 predicted 1429
6 SASI_Hs01_00223588 predicted 827
7 SASI_Hs01_00223589 predicted 1530
8 SASI_Hs02_00308050 predicted 1499
9 SASI_Hs01_00223591 predicted 852
10 SASI_Hs01_00223592 predicted 1117
11 SASI_Hs01_00223590 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053388 predicted 1794
2 SASI_Hs01_00053390 predicted 2055
3 SASI_Hs01_00053391 predicted 2015
4 SASI_Hs01_00053392 predicted 2052
5 SASI_Hs01_00053393 predicted 2082
6 SASI_Hs01_00053394 predicted 2181
7 SASI_Hs01_00053395 predicted 2198
8 SASI_Hs01_00053396 predicted 2082
9 SASI_Hs02_00334289 predicted 2362
10 SASI_Hs02_00334290 predicted 2014
11 SASI_Hs01_00053389 predicted 2257
12 SASI_Hs01_00053397 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224293 predicted 632
2 SASI_Hs01_00224294 predicted 1156
3 SASI_Hs01_00224295 predicted 570
4 SASI_Hs01_00224296 predicted 629
5 SASI_Hs01_00224297 predicted 617
6 SASI_Hs01_00224298 predicted 983
7 SASI_Hs01_00224299 predicted 545
8 SASI_Hs01_00224300 predicted 820
9 SASI_Hs01_00224301 predicted 872
10 SASI_Hs01_00224302 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036336 predicted 929
2 SASI_Hs01_00036338 predicted 1196
3 SASI_Hs01_00036339 predicted 1162
4 SASI_Hs01_00036340 predicted 1194
5 SASI_Hs01_00036341 predicted 1223
6 SASI_Hs01_00036342 predicted 1316
7 SASI_Hs01_00036343 predicted 1340
8 SASI_Hs01_00036344 predicted 1224
9 SASI_Hs02_00369443 predicted 1496
10 SASI_Hs02_00369444 predicted 1150
11 SASI_Hs01_00036337 predicted 1405
12 SASI_Hs01_00036345 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047798 predicted 1243
2 SASI_Rn01_00047799 predicted 1260
3 SASI_Rn01_00047800 predicted 1478
4 SASI_Rn01_00047801 predicted 1480
5 SASI_Rn01_00047802 predicted 601
6 SASI_Rn01_00047803 predicted 1547
7 SASI_Rn01_00047804 predicted 1115
8 SASI_Rn01_00047805 predicted 630
9 SASI_Rn01_00047806 predicted 1142
10 SASI_Rn02_00265503 predicted 1642
11 SASI_Rn01_00047807 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089891 predicted 819
2 SASI_Mm01_00089892 predicted 1471
3 SASI_Mm01_00089893 predicted 1484
4 SASI_Mm01_00089894 predicted 699
5 SASI_Mm02_00320012 predicted 743
6 SASI_Mm01_00089895 predicted 1634
7 SASI_Mm01_00089896 predicted 941
8 SASI_Mm01_00089897 predicted 1544
9 SASI_Mm01_00089898 predicted 602
10 SASI_Mm01_00089899 predicted 1310
11 SASI_Mm01_00089900 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011151
VALIDATED
PPM1B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011151.1-2161s1c1
Sequence:CCGGCCGCAATAGTATAAACCCTTACTCGAGTAAGGGTTTATACTATTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-893s1c1
Sequence:CCGGCAGGATCACAAACCTTGTAATCTCGAGATTACAAGGTTTGTGATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-892s1c1
Sequence:CCGGCCAGGATCACAAACCTTGTAACTCGAGTTACAAGGTTTGTGATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-1474s1c1
Sequence:CCGGCCATGTTATTGAAGCTGTTTACTCGAGTAAACAGCTTCAATAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-2572s21c1
Sequence:CCGGGGCTGTCACATAGGTACTTAACTCGAGTTAAGTACCTATGTGACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-1672s21c1
Sequence:GTACCGGGAGCAGAAACCATTAGCATTTCTCGAGAAATGCTAATGGTTTCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011151.1-2155s21c1
Sequence:CCGGCGGTGTCCGCAATAGTATAAACTCGAGTTTATACTATTGCGGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-2021s21c1
Sequence:CCGGAGTTTCATGTGAGCAATTTACCTCGAGGTAAATTGCTCACATGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-1872s21c1
Sequence:CCGGTATCCTCTGAAGGTGCGTTATCTCGAGATAACGCACCTTCAGAGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011151
VALIDATED
PPM1B MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011151.1-2161s1c1
Sequence:CCGGCCGCAATAGTATAAACCCTTACTCGAGTAAGGGTTTATACTATTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-893s1c1
Sequence:CCGGCAGGATCACAAACCTTGTAATCTCGAGATTACAAGGTTTGTGATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-892s1c1
Sequence:CCGGCCAGGATCACAAACCTTGTAACTCGAGTTACAAGGTTTGTGATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-1474s1c1
Sequence:CCGGCCATGTTATTGAAGCTGTTTACTCGAGTAAACAGCTTCAATAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-2572s21c1
Sequence:CCGGGGCTGTCACATAGGTACTTAACTCGAGTTAAGTACCTATGTGACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-1672s21c1
Sequence:GTACCGGGAGCAGAAACCATTAGCATTTCTCGAGAAATGCTAATGGTTTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011151.1-2155s21c1
Sequence:CCGGCGGTGTCCGCAATAGTATAAACTCGAGTTTATACTATTGCGGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-2021s21c1
Sequence:CCGGAGTTTCATGTGAGCAATTTACCTCGAGGTAAATTGCTCACATGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-1872s21c1
Sequence:CCGGTATCCTCTGAAGGTGCGTTATCTCGAGATAACGCACCTTCAGAGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011151
VALIDATED
PPM1B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011151.1-2161s1c1
Sequence:CCGGCCGCAATAGTATAAACCCTTACTCGAGTAAGGGTTTATACTATTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-893s1c1
Sequence:CCGGCAGGATCACAAACCTTGTAATCTCGAGATTACAAGGTTTGTGATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-892s1c1
Sequence:CCGGCCAGGATCACAAACCTTGTAACTCGAGTTACAAGGTTTGTGATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011151.1-1474s1c1
Sequence:CCGGCCATGTTATTGAAGCTGTTTACTCGAGTAAACAGCTTCAATAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-2572s21c1
Sequence:CCGGGGCTGTCACATAGGTACTTAACTCGAGTTAAGTACCTATGTGACAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-1672s21c1
Sequence:GTACCGGGAGCAGAAACCATTAGCATTTCTCGAGAAATGCTAATGGTTTCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011151.1-2155s21c1
Sequence:CCGGCGGTGTCCGCAATAGTATAAACTCGAGTTTATACTATTGCGGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-2021s21c1
Sequence:CCGGAGTTTCATGTGAGCAATTTACCTCGAGGTAAATTGCTCACATGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011151.1-1872s21c1
Sequence:CCGGTATCCTCTGAAGGTGCGTTATCTCGAGATAACGCACCTTCAGAGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002706
VALIDATED
PPM1B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-1534s21c1
Sequence:CCGGGACTGAATCCACATAGAGAAACTCGAGTTTCTCTATGTGGATTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-646s1c1
Sequence:CCGGCATCACTACTAACGAAGACTTCTCGAGAAGTCTTCGTTAGTAGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-1252s1c1
Sequence:CCGGACACAAGGGAAGTCGAGATAACTCGAGTTATCTCGACTTCCCTTGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-464s1c1
Sequence:CCGGGCTGGGAATGGTTTACGTTATCTCGAGATAACGTAAACCATTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-1518s1c1
Sequence:CCGGGACTGAATCCACATAGAGAAACTCGAGTTTCTCTATGTGGATTCAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002706.x-1104s1c1
Sequence:CCGGGAGCAGAAGAGGATGAATTTACTCGAGTAAATTCATCCTCTTCTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-662s21c1
Sequence:CCGGCATCACTACTAACGAAGACTTCTCGAGAAGTCTTCGTTAGTAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-480s21c1
Sequence:CCGGGCTGGGAATGGTTTACGTTATCTCGAGATAACGTAAACCATTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-1268s21c1
Sequence:CCGGACACAAGGGAAGTCGAGATAACTCGAGTTATCTCGACTTCCCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002706
VALIDATED
PPM1B MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-1534s21c1
Sequence:CCGGGACTGAATCCACATAGAGAAACTCGAGTTTCTCTATGTGGATTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-646s1c1
Sequence:CCGGCATCACTACTAACGAAGACTTCTCGAGAAGTCTTCGTTAGTAGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-1252s1c1
Sequence:CCGGACACAAGGGAAGTCGAGATAACTCGAGTTATCTCGACTTCCCTTGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-464s1c1
Sequence:CCGGGCTGGGAATGGTTTACGTTATCTCGAGATAACGTAAACCATTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-1518s1c1
Sequence:CCGGGACTGAATCCACATAGAGAAACTCGAGTTTCTCTATGTGGATTCAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002706.x-1104s1c1
Sequence:CCGGGAGCAGAAGAGGATGAATTTACTCGAGTAAATTCATCCTCTTCTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-662s21c1
Sequence:CCGGCATCACTACTAACGAAGACTTCTCGAGAAGTCTTCGTTAGTAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-480s21c1
Sequence:CCGGGCTGGGAATGGTTTACGTTATCTCGAGATAACGTAAACCATTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-1268s21c1
Sequence:CCGGACACAAGGGAAGTCGAGATAACTCGAGTTATCTCGACTTCCCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002706
VALIDATED
PPM1B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-1534s21c1
Sequence:CCGGGACTGAATCCACATAGAGAAACTCGAGTTTCTCTATGTGGATTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-646s1c1
Sequence:CCGGCATCACTACTAACGAAGACTTCTCGAGAAGTCTTCGTTAGTAGTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-1252s1c1
Sequence:CCGGACACAAGGGAAGTCGAGATAACTCGAGTTATCTCGACTTCCCTTGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-464s1c1
Sequence:CCGGGCTGGGAATGGTTTACGTTATCTCGAGATAACGTAAACCATTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002706.x-1518s1c1
Sequence:CCGGGACTGAATCCACATAGAGAAACTCGAGTTTCTCTATGTGGATTCAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002706.x-1104s1c1
Sequence:CCGGGAGCAGAAGAGGATGAATTTACTCGAGTAAATTCATCCTCTTCTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-662s21c1
Sequence:CCGGCATCACTACTAACGAAGACTTCTCGAGAAGTCTTCGTTAGTAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-480s21c1
Sequence:CCGGGCTGGGAATGGTTTACGTTATCTCGAGATAACGTAAACCATTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002706.4-1268s21c1
Sequence:CCGGACACAAGGGAAGTCGAGATAACTCGAGTTATCTCGACTTCCCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)