EMAIL THIS PAGE TO A FRIEND

PPM1D

protein phosphatase, Mg2+/Mn2+ dependent, 1D

154 Gene Product Result for
Synonyms: PP2C-DELTA WIP1
UniProtKB ID: O15297, Q53XP4
Gene ID:
Human(8493) Summary: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
Mouse(53892) protein phosphatase 1D magnesium-dependent, delta isoform
Rat(287585) protein phosphatase, Mg2+/Mn2+ dependent, 1D
chicken(417644) protein phosphatase, Mg2+/Mn2+ dependent, 1D
domestic cat(101089556) protein phosphatase, Mg2+/Mn2+ dependent, 1D
Horse(100071325) protein phosphatase, Mg2+/Mn2+ dependent, 1D
dog(612934) protein phosphatase, Mg2+/Mn2+ dependent, 1D
cow(514005) protein phosphatase, Mg2+/Mn2+ dependent, 1D
sheep(101108932) protein phosphatase, Mg2+/Mn2+ dependent, 1D
domestic guinea pig(100731559) protein phosphatase, Mg2+/Mn2+ dependent, 1D
naked mole-rat(101698863) protein phosphatase, Mg2+/Mn2+ dependent, 1D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003620 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003620 siRNAs that have been validated in the lab human pricing
NM_001105825 Rosetta Predictions rat pricing
NM_016910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003620 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064940 validated 1432
2 SASI_Hs01_00064942 predicted 1646
3 SASI_Hs01_00064944 predicted 1350
4 SASI_Hs01_00064945 predicted 1002
5 SASI_Hs01_00064946 predicted 1701
6 SASI_Hs01_00064947 predicted 981
7 SASI_Hs01_00064948 predicted 1374
8 SASI_Hs02_00335965 predicted 680
9 SASI_Hs01_00064949 predicted 937
10 SASI_Hs02_00335966 predicted 1829
11 SASI_Hs01_00064941 predicted 1182
12 SASI_Hs01_00064943 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212896 predicted 2100
2 SASI_Rn02_00212897 predicted 1402
3 SASI_Rn02_00212898 predicted 1158
4 SASI_Rn02_00212899 predicted 2034
5 SASI_Rn02_00212900 predicted 1454
6 SASI_Rn02_00212901 predicted 1844
7 SASI_Rn02_00212902 predicted 1636
8 SASI_Rn02_00212903 predicted 1375
9 SASI_Rn02_00212904 predicted 1414
10 SASI_Rn02_00212905 predicted 1736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323769 predicted 1354
2 SASI_Mm01_00098838 predicted 1279
3 SASI_Mm01_00098839 predicted 1162
4 SASI_Mm02_00323770 predicted 661
5 SASI_Mm01_00098840 predicted 706
6 SASI_Mm01_00098841 predicted 974
7 SASI_Mm01_00098842 predicted 1379
8 SASI_Mm01_00098844 predicted 1634
9 SASI_Mm01_00098845 predicted 1143
10 SASI_Mm01_00098846 predicted 836
11 SASI_Mm01_00098843 predicted 1652
12 SASI_Mm01_00098847 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016910
VALIDATED
PPM1D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1D
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-657s21c1
Sequence:CCGGGTGGAAGAAACTGGCAGAATGCTCGAGCATTCTGCCAGTTTCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016910.2-716s21c1
Sequence:CCGGCAACTGCCAGTGTGGTTATAACTCGAGTTATAACCACACTGGCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-831s21c1
Sequence:CCGGGGAGGTGACACAAGATCACAACTCGAGTTGTGATCTTGTGTCACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-890s21c1
Sequence:CCGGTTGGCGGCAGTGTGATGAACACTCGAGTGTTCATCACACTGCCGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-798s21c1
Sequence:CCGGGGATGACCCAAAGGATGATTTCTCGAGAAATCATCCTTTGGGTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016910.2-2152s1c1
Sequence:CCGGGCCTTGTACTTGCCTGTATTACTCGAGTAATACAGGCAAGTACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016910.2-1639s1c1
Sequence:CCGGGCCCTGACTTTAAGGATTCATCTCGAGATGAATCCTTAAAGTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016910.2-1750s1c1
Sequence:CCGGCCAGGTCAAATGAAAGCTCAACTCGAGTTGAGCTTTCATTTGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016910.2-1450s1c1
Sequence:CCGGCCAATCAAGTCACCGGAAGAACTCGAGTTCTTCCGGTGACTTGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016910.2-1380s1c1
Sequence:CCGGCCTGACTGATAGCCCTACTTACTCGAGTAAGTAGGGCTATCAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016910
VALIDATED
PPM1D MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1D
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-657s21c1
Sequence:CCGGGTGGAAGAAACTGGCAGAATGCTCGAGCATTCTGCCAGTTTCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016910.2-716s21c1
Sequence:CCGGCAACTGCCAGTGTGGTTATAACTCGAGTTATAACCACACTGGCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-831s21c1
Sequence:CCGGGGAGGTGACACAAGATCACAACTCGAGTTGTGATCTTGTGTCACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-890s21c1
Sequence:CCGGTTGGCGGCAGTGTGATGAACACTCGAGTGTTCATCACACTGCCGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-798s21c1
Sequence:CCGGGGATGACCCAAAGGATGATTTCTCGAGAAATCATCCTTTGGGTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016910.2-2152s1c1
Sequence:CCGGGCCTTGTACTTGCCTGTATTACTCGAGTAATACAGGCAAGTACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016910.2-1639s1c1
Sequence:CCGGGCCCTGACTTTAAGGATTCATCTCGAGATGAATCCTTAAAGTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016910.2-1750s1c1
Sequence:CCGGCCAGGTCAAATGAAAGCTCAACTCGAGTTGAGCTTTCATTTGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016910.2-1450s1c1
Sequence:CCGGCCAATCAAGTCACCGGAAGAACTCGAGTTCTTCCGGTGACTTGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016910.2-1380s1c1
Sequence:CCGGCCTGACTGATAGCCCTACTTACTCGAGTAAGTAGGGCTATCAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016910
VALIDATED
PPM1D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1D
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-657s21c1
Sequence:CCGGGTGGAAGAAACTGGCAGAATGCTCGAGCATTCTGCCAGTTTCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016910.2-716s21c1
Sequence:CCGGCAACTGCCAGTGTGGTTATAACTCGAGTTATAACCACACTGGCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-831s21c1
Sequence:CCGGGGAGGTGACACAAGATCACAACTCGAGTTGTGATCTTGTGTCACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-890s21c1
Sequence:CCGGTTGGCGGCAGTGTGATGAACACTCGAGTGTTCATCACACTGCCGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016910.2-798s21c1
Sequence:CCGGGGATGACCCAAAGGATGATTTCTCGAGAAATCATCCTTTGGGTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016910.2-2152s1c1
Sequence:CCGGGCCTTGTACTTGCCTGTATTACTCGAGTAATACAGGCAAGTACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016910.2-1639s1c1
Sequence:CCGGGCCCTGACTTTAAGGATTCATCTCGAGATGAATCCTTAAAGTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016910.2-1750s1c1
Sequence:CCGGCCAGGTCAAATGAAAGCTCAACTCGAGTTGAGCTTTCATTTGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016910.2-1450s1c1
Sequence:CCGGCCAATCAAGTCACCGGAAGAACTCGAGTTCTTCCGGTGACTTGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016910.2-1380s1c1
Sequence:CCGGCCTGACTGATAGCCCTACTTACTCGAGTAAGTAGGGCTATCAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003620
VALIDATED
PPM1D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003620.2-2615s21c1
Sequence:CCGGGTTAGTCTTGTCCCAATTAAACTCGAGTTTAATTGGGACAAGACTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-1710s21c1
Sequence:CCGGTGGCCTTGTGCCTACTAATTCCTCGAGGAATTAGTAGGCACAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003620.2-1127s21c1
Sequence:CCGGACCCTCAGAAGCACAAGTATACTCGAGTATACTTGTGCTTCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-1050s21c1
Sequence:CCGGTGATTTGTGGAGCTATGATTTCTCGAGAAATCATAGCTCCACAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-282s21c1
Sequence:CCGGCATGGAGGACGTTACTCAAATCTCGAGATTTGAGTAACGTCCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003620.x-1357s1c1
Sequence:CCGGGTGGACAATCAGGGAAACTTTCTCGAGAAAGTTTCCCTGATTGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003620.x-2807s1c1
Sequence:CCGGCCCTTCTCGTGTTTGCTTAAACTCGAGTTTAAGCAAACACGAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1779s1c1
Sequence:CCGGCCAAATGAAAGCCCAAGAAATCTCGAGATTTCTTGGGCTTTCATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1129s1c1
Sequence:CCGGCCTCAGAAGCACAAGTATATTCTCGAGAATATACTTGTGCTTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1594s1c1
Sequence:CCGGCGAGAGAATGTCCAAGGTGTACTCGAGTACACCTTGGACATTCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003620
VALIDATED
PPM1D MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003620.2-2615s21c1
Sequence:CCGGGTTAGTCTTGTCCCAATTAAACTCGAGTTTAATTGGGACAAGACTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-1710s21c1
Sequence:CCGGTGGCCTTGTGCCTACTAATTCCTCGAGGAATTAGTAGGCACAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003620.2-1127s21c1
Sequence:CCGGACCCTCAGAAGCACAAGTATACTCGAGTATACTTGTGCTTCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-1050s21c1
Sequence:CCGGTGATTTGTGGAGCTATGATTTCTCGAGAAATCATAGCTCCACAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-282s21c1
Sequence:CCGGCATGGAGGACGTTACTCAAATCTCGAGATTTGAGTAACGTCCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003620.x-1357s1c1
Sequence:CCGGGTGGACAATCAGGGAAACTTTCTCGAGAAAGTTTCCCTGATTGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003620.x-2807s1c1
Sequence:CCGGCCCTTCTCGTGTTTGCTTAAACTCGAGTTTAAGCAAACACGAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1779s1c1
Sequence:CCGGCCAAATGAAAGCCCAAGAAATCTCGAGATTTCTTGGGCTTTCATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1129s1c1
Sequence:CCGGCCTCAGAAGCACAAGTATATTCTCGAGAATATACTTGTGCTTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1594s1c1
Sequence:CCGGCGAGAGAATGTCCAAGGTGTACTCGAGTACACCTTGGACATTCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003620
VALIDATED
PPM1D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003620.2-2615s21c1
Sequence:CCGGGTTAGTCTTGTCCCAATTAAACTCGAGTTTAATTGGGACAAGACTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-1710s21c1
Sequence:CCGGTGGCCTTGTGCCTACTAATTCCTCGAGGAATTAGTAGGCACAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003620.2-1127s21c1
Sequence:CCGGACCCTCAGAAGCACAAGTATACTCGAGTATACTTGTGCTTCTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-1050s21c1
Sequence:CCGGTGATTTGTGGAGCTATGATTTCTCGAGAAATCATAGCTCCACAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003620.2-282s21c1
Sequence:CCGGCATGGAGGACGTTACTCAAATCTCGAGATTTGAGTAACGTCCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003620.x-1357s1c1
Sequence:CCGGGTGGACAATCAGGGAAACTTTCTCGAGAAAGTTTCCCTGATTGTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003620.x-2807s1c1
Sequence:CCGGCCCTTCTCGTGTTTGCTTAAACTCGAGTTTAAGCAAACACGAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1779s1c1
Sequence:CCGGCCAAATGAAAGCCCAAGAAATCTCGAGATTTCTTGGGCTTTCATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1129s1c1
Sequence:CCGGCCTCAGAAGCACAAGTATATTCTCGAGAATATACTTGTGCTTCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003620.x-1594s1c1
Sequence:CCGGCGAGAGAATGTCCAAGGTGTACTCGAGTACACCTTGGACATTCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)