EMAIL THIS PAGE TO A FRIEND

PPM1E

protein phosphatase, Mg2+/Mn2+ dependent, 1E

219 Gene Product Result for
Synonyms: CaMKP-N POPX1 PP2CH caMKN
UniProtKB ID: Q8WY54, Q68DW1, Q7LAF3, Q9UPT0
Gene ID:
Human(22843) Summary: This gene encodes a member of the PPM family of serine/threonine-protein phosphatases. The encoded protein is localized to the nucleus and dephosphorylates and inactivates multiple substrates including serine/threonine-protein kinase PAK 1, 5'-AMP-activated protein kinase (AMPK) and the multifunctional calcium/calmodulin-dependent protein kinases. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(320472) protein phosphatase 1E (PP2C domain containing)
Rat(360593) protein phosphatase, Mg2+/Mn2+ dependent, 1E
Zebrafish(553417) protein phosphatase 1E (PP2C domain containing)
domestic cat(101081844) protein phosphatase, Mg2+/Mn2+ dependent, 1E
dog(612897) protein phosphatase, Mg2+/Mn2+ dependent, 1E
chicken(417627) protein phosphatase, Mg2+/Mn2+ dependent, 1E
naked mole-rat(101717082) protein phosphatase, Mg2+/Mn2+ dependent, 1E
domestic guinea pig(100727584) protein phosphatase, Mg2+/Mn2+ dependent, 1E
cow(532050) protein phosphatase, Mg2+/Mn2+ dependent, 1E
sheep(101106345) protein phosphatase, Mg2+/Mn2+ dependent, 1E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014906 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084571 MISSION® esiRNA esiRNA targeting mouse Ppm1e (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014906 Rosetta Predictions human pricing
NM_198773 Rosetta Predictions rat pricing
NM_177167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224955 predicted 1557
2 SASI_Hs01_00224956 predicted 1591
3 SASI_Hs02_00346543 predicted 2356
4 SASI_Hs01_00224957 predicted 2105
5 SASI_Hs01_00224958 predicted 2143
6 SASI_Hs01_00224959 predicted 963
7 SASI_Hs01_00224961 predicted 1747
8 SASI_Hs01_00224962 predicted 1681
9 SASI_Hs02_00346544 predicted 799
10 SASI_Hs01_00224963 predicted 2243
11 SASI_Hs01_00224960 predicted 2444
12 SASI_Hs01_00224964 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103910 predicted 1578
2 SASI_Rn01_00103911 predicted 2045
3 SASI_Rn01_00103912 predicted 1902
4 SASI_Rn01_00103914 predicted 745
5 SASI_Rn02_00270021 predicted 1676
6 SASI_Rn01_00103915 predicted 1745
7 SASI_Rn01_00103916 predicted 1667
8 SASI_Rn01_00103917 predicted 1605
9 SASI_Rn01_00103918 predicted 1354
10 SASI_Rn02_00270022 predicted 1365
11 SASI_Rn01_00103909 predicted 1820
12 SASI_Rn01_00103913 predicted 2000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099774 predicted 1783
2 SASI_Mm01_00099775 predicted 1548
3 SASI_Mm01_00099776 predicted 2261
4 SASI_Mm01_00099777 predicted 2271
5 SASI_Mm01_00099778 predicted 2118
6 SASI_Mm01_00099779 predicted 1562
7 SASI_Mm02_00347157 predicted 1307
8 SASI_Mm01_00099780 predicted 2295
9 SASI_Mm01_00099781 predicted 829
10 SASI_Mm01_00099783 predicted 2071
11 SASI_Mm01_00099782 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177167
PPM1E MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177167.3-2680s1c1
Sequence:CCGGGCCTACTCTAAAGGAAACAATCTCGAGATTGTTTCCTTTAGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-620s1c1
Sequence:CCGGGCTCACTGTATCCCAAAGGAACTCGAGTTCCTTTGGGATACAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-920s1c1
Sequence:CCGGGCTGCTATTTATGCCTCCGTTCTCGAGAACGGAGGCATAAATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-2107s1c1
Sequence:CCGGGCAGCGTGGATTCAGGTTTAACTCGAGTTAAACCTGAATCCACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-2066s1c1
Sequence:CCGGGCGTCTAGGTTGTATCATTTACTCGAGTAAATGATACAACCTAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177167
PPM1E MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177167.3-2680s1c1
Sequence:CCGGGCCTACTCTAAAGGAAACAATCTCGAGATTGTTTCCTTTAGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-620s1c1
Sequence:CCGGGCTCACTGTATCCCAAAGGAACTCGAGTTCCTTTGGGATACAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-920s1c1
Sequence:CCGGGCTGCTATTTATGCCTCCGTTCTCGAGAACGGAGGCATAAATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-2107s1c1
Sequence:CCGGGCAGCGTGGATTCAGGTTTAACTCGAGTTAAACCTGAATCCACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-2066s1c1
Sequence:CCGGGCGTCTAGGTTGTATCATTTACTCGAGTAAATGATACAACCTAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177167
PPM1E MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177167.3-2680s1c1
Sequence:CCGGGCCTACTCTAAAGGAAACAATCTCGAGATTGTTTCCTTTAGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-620s1c1
Sequence:CCGGGCTCACTGTATCCCAAAGGAACTCGAGTTCCTTTGGGATACAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-920s1c1
Sequence:CCGGGCTGCTATTTATGCCTCCGTTCTCGAGAACGGAGGCATAAATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-2107s1c1
Sequence:CCGGGCAGCGTGGATTCAGGTTTAACTCGAGTTAAACCTGAATCCACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177167.3-2066s1c1
Sequence:CCGGGCGTCTAGGTTGTATCATTTACTCGAGTAAATGATACAACCTAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014906
VALIDATED
PPM1E MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014906.x-707s1c1
Sequence:CCGGGTGGAGATTGAGACAGTGAAACTCGAGTTTCACTGTCTCAATCTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014906.x-804s1c1
Sequence:CCGGCCCAGCTTTATTATGAGACATCTCGAGATGTCTCATAATAAAGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014906.x-2128s1c1
Sequence:CCGGGTCTCATTTACGCCACCACTACTCGAGTAGTGGTGGCGTAAATGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014906.3-1343s21c1
Sequence:GTACCGGGCTGAACATAAGCCATATATCCTCGAGGATATATGGCTTATGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014906.3-707s21c1
Sequence:CCGGGTGGAGATTGAGACAGTGAAACTCGAGTTTCACTGTCTCAATCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-174s21c1
Sequence:CCGGAGCTATTCCTGGGCGAGTTTCCTCGAGGAAACTCGCCCAGGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-2366s21c1
Sequence:CCGGGATCTTCCTTGGAGCTATAAACTCGAGTTTATAGCTCCAAGGAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-744s21c1
Sequence:CCGGTCAGCAAACTACACGAGATTTCTCGAGAAATCTCGTGTAGTTTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-4902s21c1
Sequence:CCGGCCCTCTAACTAATGGTATCTACTCGAGTAGATACCATTAGTTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014906
VALIDATED
PPM1E MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014906.x-707s1c1
Sequence:CCGGGTGGAGATTGAGACAGTGAAACTCGAGTTTCACTGTCTCAATCTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014906.x-804s1c1
Sequence:CCGGCCCAGCTTTATTATGAGACATCTCGAGATGTCTCATAATAAAGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014906.x-2128s1c1
Sequence:CCGGGTCTCATTTACGCCACCACTACTCGAGTAGTGGTGGCGTAAATGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014906.3-1343s21c1
Sequence:GTACCGGGCTGAACATAAGCCATATATCCTCGAGGATATATGGCTTATGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014906.3-707s21c1
Sequence:CCGGGTGGAGATTGAGACAGTGAAACTCGAGTTTCACTGTCTCAATCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-174s21c1
Sequence:CCGGAGCTATTCCTGGGCGAGTTTCCTCGAGGAAACTCGCCCAGGAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-2366s21c1
Sequence:CCGGGATCTTCCTTGGAGCTATAAACTCGAGTTTATAGCTCCAAGGAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-744s21c1
Sequence:CCGGTCAGCAAACTACACGAGATTTCTCGAGAAATCTCGTGTAGTTTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-4902s21c1
Sequence:CCGGCCCTCTAACTAATGGTATCTACTCGAGTAGATACCATTAGTTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014906
VALIDATED
PPM1E MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014906.x-707s1c1
Sequence:CCGGGTGGAGATTGAGACAGTGAAACTCGAGTTTCACTGTCTCAATCTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014906.x-804s1c1
Sequence:CCGGCCCAGCTTTATTATGAGACATCTCGAGATGTCTCATAATAAAGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014906.x-2128s1c1
Sequence:CCGGGTCTCATTTACGCCACCACTACTCGAGTAGTGGTGGCGTAAATGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014906.3-1343s21c1
Sequence:GTACCGGGCTGAACATAAGCCATATATCCTCGAGGATATATGGCTTATGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014906.3-707s21c1
Sequence:CCGGGTGGAGATTGAGACAGTGAAACTCGAGTTTCACTGTCTCAATCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-174s21c1
Sequence:CCGGAGCTATTCCTGGGCGAGTTTCCTCGAGGAAACTCGCCCAGGAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-2366s21c1
Sequence:CCGGGATCTTCCTTGGAGCTATAAACTCGAGTTTATAGCTCCAAGGAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-744s21c1
Sequence:CCGGTCAGCAAACTACACGAGATTTCTCGAGAAATCTCGTGTAGTTTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014906.3-4902s21c1
Sequence:CCGGCCCTCTAACTAATGGTATCTACTCGAGTAGATACCATTAGTTAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)