EMAIL THIS PAGE TO A FRIEND

PPM1F

protein phosphatase, Mg2+/Mn2+ dependent, 1F

62 Gene Product Result for
Synonyms: CAMKP CaMKPase FEM-2 POPX2 hFEM-2
UniProtKB ID: P49593, A8K6G3, Q96PM2
Gene ID:
Human(9647) Summary: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(68606) protein phosphatase 1F (PP2C domain containing)
Rat(287931) protein phosphatase, Mg2+/Mn2+ dependent, 1F
cow(618210) protein phosphatase, Mg2+/Mn2+ dependent, 1F
sheep(101114979) protein phosphatase, Mg2+/Mn2+ dependent, 1F
domestic guinea pig(100715460) protein phosphatase, Mg2+/Mn2+ dependent, 1F
naked mole-rat(101699789) protein phosphatase, Mg2+/Mn2+ dependent, 1F
Zebrafish(553757) protein phosphatase 1F (PP2C domain containing)
Horse(100057884) protein phosphatase, Mg2+/Mn2+ dependent, 1F
domestic cat(101087876) protein phosphatase, Mg2+/Mn2+ dependent, 1F
dog(486448) protein phosphatase, Mg2+/Mn2+ dependent, 1F
chicken(416772) protein phosphatase, Mg2+/Mn2+ dependent, 1F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014634 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031201 MISSION® esiRNA targeting mouse Ppm1f mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014634 Rosetta Predictions human pricing
NM_175755 Rosetta Predictions rat pricing
NM_176833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138324 predicted 1691
2 SASI_Hs01_00138325 predicted 1939
3 SASI_Hs01_00138326 predicted 827
4 SASI_Hs01_00138328 predicted 733
5 SASI_Hs01_00138330 predicted 1680
6 SASI_Hs01_00138331 predicted 1330
7 SASI_Hs01_00138332 predicted 684
8 SASI_Hs01_00138333 predicted 1000
9 SASI_Hs02_00345939 predicted 990
10 SASI_Hs02_00345940 predicted 830
11 SASI_Hs01_00138327 predicted 1333
12 SASI_Hs01_00138329 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066708 predicted 785
2 SASI_Rn01_00066709 predicted 795
3 SASI_Rn02_00269510 predicted 962
4 SASI_Rn01_00066710 predicted 792
5 SASI_Rn01_00066711 predicted 615
6 SASI_Rn01_00066713 predicted 944
7 SASI_Rn01_00066714 predicted 779
8 SASI_Rn01_00066715 predicted 647
9 SASI_Rn01_00066716 predicted 971
10 SASI_Rn01_00066717 predicted 682
11 SASI_Rn01_00066712 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084425 predicted 1761
2 SASI_Mm01_00084426 predicted 599
3 SASI_Mm02_00346720 predicted 971
4 SASI_Mm01_00084427 predicted 767
5 SASI_Mm01_00084430 predicted 1387
6 SASI_Mm01_00084431 predicted 1617
7 SASI_Mm01_00084432 predicted 1801
8 SASI_Mm01_00084433 predicted 630
9 SASI_Mm01_00084434 predicted 947
10 SASI_Mm02_00346721 predicted 1273
11 SASI_Mm01_00084428 predicted 1186
12 SASI_Mm01_00084429 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176833
PPM1F MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1F
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1207s21c1
Sequence:CCGGAGGGCAATGGGATGCGTATTGCTCGAGCAATACGCATCCCATTGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-682s21c1
Sequence:CCGGATGCCTCTGTCCACGTGCATACTCGAGTATGCACGTGGACAGAGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1390s21c1
Sequence:CCGGCAGAACTTGAGATCAGTAATACTCGAGTATTACTGATCTCAAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1134s21c1
Sequence:CCGGTGTGATGGTTTCTTCGATGTTCTCGAGAACATCGAAGAAACCATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-632s1c1
Sequence:CCGGCGTGCCTACTTTGCTGTGTTTCTCGAGAAACACAGCAAAGTAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-404s1c1
Sequence:CCGGGCCCTCGTGACCTTACTAGATCTCGAGATCTAGTAAGGTCACGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176833.2-2922s1c1
Sequence:CCGGCCAGAGAATAATGGTGGCTTACTCGAGTAAGCCACCATTATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-410s1c1
Sequence:CCGGGTGACCTTACTAGATGCCAAACTCGAGTTTGGCATCTAGTAAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-950s1c1
Sequence:CCGGCAGGATGAGAAAGCACGAATTCTCGAGAATTCGTGCTTTCTCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-333s21c1
Sequence:CCGGACAGACCTTTCTGAATTTAAGCTCGAGCTTAAATTCAGAAAGGTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176833
PPM1F MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1F
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1207s21c1
Sequence:CCGGAGGGCAATGGGATGCGTATTGCTCGAGCAATACGCATCCCATTGCCCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000418722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-682s21c1
Sequence:CCGGATGCCTCTGTCCACGTGCATACTCGAGTATGCACGTGGACAGAGGCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1390s21c1
Sequence:CCGGCAGAACTTGAGATCAGTAATACTCGAGTATTACTGATCTCAAGTTCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000417308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1134s21c1
Sequence:CCGGTGTGATGGTTTCTTCGATGTTCTCGAGAACATCGAAGAAACCATCACATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-632s1c1
Sequence:CCGGCGTGCCTACTTTGCTGTGTTTCTCGAGAAACACAGCAAAGTAGGCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-404s1c1
Sequence:CCGGGCCCTCGTGACCTTACTAGATCTCGAGATCTAGTAAGGTCACGAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176833.2-2922s1c1
Sequence:CCGGCCAGAGAATAATGGTGGCTTACTCGAGTAAGCCACCATTATTCTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-410s1c1
Sequence:CCGGGTGACCTTACTAGATGCCAAACTCGAGTTTGGCATCTAGTAAGGTCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-950s1c1
Sequence:CCGGCAGGATGAGAAAGCACGAATTCTCGAGAATTCGTGCTTTCTCATCCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000413290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-333s21c1
Sequence:CCGGACAGACCTTTCTGAATTTAAGCTCGAGCTTAAATTCAGAAAGGTCTGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176833
PPM1F MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1F
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1207s21c1
Sequence:CCGGAGGGCAATGGGATGCGTATTGCTCGAGCAATACGCATCCCATTGCCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-682s21c1
Sequence:CCGGATGCCTCTGTCCACGTGCATACTCGAGTATGCACGTGGACAGAGGCATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1390s21c1
Sequence:CCGGCAGAACTTGAGATCAGTAATACTCGAGTATTACTGATCTCAAGTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-1134s21c1
Sequence:CCGGTGTGATGGTTTCTTCGATGTTCTCGAGAACATCGAAGAAACCATCACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-632s1c1
Sequence:CCGGCGTGCCTACTTTGCTGTGTTTCTCGAGAAACACAGCAAAGTAGGCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-404s1c1
Sequence:CCGGGCCCTCGTGACCTTACTAGATCTCGAGATCTAGTAAGGTCACGAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176833.2-2922s1c1
Sequence:CCGGCCAGAGAATAATGGTGGCTTACTCGAGTAAGCCACCATTATTCTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-410s1c1
Sequence:CCGGGTGACCTTACTAGATGCCAAACTCGAGTTTGGCATCTAGTAAGGTCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176833.2-950s1c1
Sequence:CCGGCAGGATGAGAAAGCACGAATTCTCGAGAATTCGTGCTTTCTCATCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176833.3-333s21c1
Sequence:CCGGACAGACCTTTCTGAATTTAAGCTCGAGCTTAAATTCAGAAAGGTCTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014634
VALIDATED
PPM1F MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1F
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-1022s21c1
Sequence:CCGGTTGAAGCATTGGGTGGCTTTGCTCGAGCAAAGCCACCCAATGCTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014634.2-1725s21c1
Sequence:CCGGCTTGCTCCCAGCTCCTATTAGCTCGAGCTAATAGGAGCTGGGAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-485s21c1
Sequence:CCGGGCCTGGCACAGAGTTTCTTTACTCGAGTAAAGAAACTCTGTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014634.x-685s1c1
Sequence:CCGGCGCGCCTACTTTGCTGTGTTTCTCGAGAAACACAGCAAAGTAGGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014634.x-988s1c1
Sequence:CCGGCACAGACCAGAACGGCAGGATCTCGAGATCCTGCCGTTCTGGTCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014634.x-1192s1c1
Sequence:CCGGGATGGCTTCTTTGACGTCGTACTCGAGTACGACGTCAAAGAAGCCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_014634.x-378s1c1
Sequence:CCGGACAGACAGACCTTTCCGAATTCTCGAGAATTCGGAAAGGTCTGTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-1467s21c1
Sequence:CCGGACCAAGAAGCTAGGTGGTTTCCTCGAGGAAACCACCTAGCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-880s21c1
Sequence:CCGGACAGGTGTGTGTGCGCTCATTCTCGAGAATGAGCGCACACACACCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014634
VALIDATED
PPM1F MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1F
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-1022s21c1
Sequence:CCGGTTGAAGCATTGGGTGGCTTTGCTCGAGCAAAGCCACCCAATGCTTCAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014634.2-1725s21c1
Sequence:CCGGCTTGCTCCCAGCTCCTATTAGCTCGAGCTAATAGGAGCTGGGAGCAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000378140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-485s21c1
Sequence:CCGGGCCTGGCACAGAGTTTCTTTACTCGAGTAAAGAAACTCTGTGCCAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014634.x-685s1c1
Sequence:CCGGCGCGCCTACTTTGCTGTGTTTCTCGAGAAACACAGCAAAGTAGGCGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014634.x-988s1c1
Sequence:CCGGCACAGACCAGAACGGCAGGATCTCGAGATCCTGCCGTTCTGGTCTGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014634.x-1192s1c1
Sequence:CCGGGATGGCTTCTTTGACGTCGTACTCGAGTACGACGTCAAAGAAGCCATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_014634.x-378s1c1
Sequence:CCGGACAGACAGACCTTTCCGAATTCTCGAGAATTCGGAAAGGTCTGTCTGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000368331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-1467s21c1
Sequence:CCGGACCAAGAAGCTAGGTGGTTTCCTCGAGGAAACCACCTAGCTTCTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000426572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-880s21c1
Sequence:CCGGACAGGTGTGTGTGCGCTCATTCTCGAGAATGAGCGCACACACACCTGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014634
VALIDATED
PPM1F MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1F
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-1022s21c1
Sequence:CCGGTTGAAGCATTGGGTGGCTTTGCTCGAGCAAAGCCACCCAATGCTTCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000355789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014634.2-1725s21c1
Sequence:CCGGCTTGCTCCCAGCTCCTATTAGCTCGAGCTAATAGGAGCTGGGAGCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-485s21c1
Sequence:CCGGGCCTGGCACAGAGTTTCTTTACTCGAGTAAAGAAACTCTGTGCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014634.x-685s1c1
Sequence:CCGGCGCGCCTACTTTGCTGTGTTTCTCGAGAAACACAGCAAAGTAGGCGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014634.x-988s1c1
Sequence:CCGGCACAGACCAGAACGGCAGGATCTCGAGATCCTGCCGTTCTGGTCTGTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014634.x-1192s1c1
Sequence:CCGGGATGGCTTCTTTGACGTCGTACTCGAGTACGACGTCAAAGAAGCCATCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_014634.x-378s1c1
Sequence:CCGGACAGACAGACCTTTCCGAATTCTCGAGAATTCGGAAAGGTCTGTCTGTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000368331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-1467s21c1
Sequence:CCGGACCAAGAAGCTAGGTGGTTTCCTCGAGGAAACCACCTAGCTTCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014634.2-880s21c1
Sequence:CCGGACAGGTGTGTGTGCGCTCATTCTCGAGAATGAGCGCACACACACCTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???