EMAIL THIS PAGE TO A FRIEND

PPM1H

protein phosphatase, Mg2+/Mn2+ dependent, 1H

135 Gene Product Result for
Synonyms: ARHCL1 NERPP-2C URCC2
UniProtKB ID: Q9ULR3, B1Q2A9, B2RXG4, Q6PI86
Gene ID:
Mouse(319468) protein phosphatase 1H (PP2C domain containing)
Rat(314897) protein phosphatase, Mg2+/Mn2+ dependent, 1H
cow(614880) protein phosphatase, Mg2+/Mn2+ dependent, 1H
sheep(101117068) protein phosphatase, Mg2+/Mn2+ dependent, 1H
domestic guinea pig(100714877) protein phosphatase, Mg2+/Mn2+ dependent, 1H
naked mole-rat(101718174) protein phosphatase, Mg2+/Mn2+ dependent, 1H
Zebrafish(768291) protein phosphatase, Mg2+/Mn2+ dependent, 1H
chicken(771760) protein phosphatase, Mg2+/Mn2+ dependent, 1H
domestic cat(101099984) protein phosphatase, Mg2+/Mn2+ dependent, 1H
Horse(100056057) protein phosphatase, Mg2+/Mn2+ dependent, 1H
dog(474425) protein phosphatase, Mg2+/Mn2+ dependent, 1H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_350880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_350880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_350880 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025591 MISSION® esiRNA esiRNA human PPM1H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020700 Rosetta Predictions human pricing
XM_350880 Rosetta Predictions human pricing
NM_001013173 Rosetta Predictions rat pricing
NM_001110218 Rosetta Predictions mouse pricing
NM_176919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353695 predicted 1431
2 SASI_Hs02_00353696 predicted 1003
3 SASI_Hs02_00353697 predicted 1192
4 SASI_Hs02_00353698 predicted 1390
5 SASI_Hs02_00353699 predicted 961
6 SASI_Hs02_00353700 predicted 1524
7 SASI_Hs02_00353701 predicted 1119
8 SASI_Hs02_00353702 predicted 1671
9 SASI_Hs02_00353703 predicted 1286
10 SASI_Hs02_00353704 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_350880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272406 predicted 1165
2 SASI_Hs01_00272407 predicted 743
3 SASI_Hs01_00272408 predicted 927
4 SASI_Hs01_00272409 predicted 308
5 SASI_Hs01_00272410 predicted 1128
6 SASI_Hs01_00272411 predicted 699
7 SASI_Hs01_00272412 predicted 1385
8 SASI_Hs01_00272413 predicted 868
9 SASI_Hs01_00272414 predicted 1271
10 SASI_Hs01_00272415 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073836 predicted 847
2 SASI_Rn01_00073837 predicted 634
3 SASI_Rn01_00073838 predicted 932
4 SASI_Rn01_00073839 predicted 412
5 SASI_Rn01_00073840 predicted 622
6 SASI_Rn01_00073841 predicted 225
7 SASI_Rn01_00073842 predicted 1026
8 SASI_Rn01_00073843 predicted 916
9 SASI_Rn01_00073844 predicted 768
10 SASI_Rn01_00073845 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305006 predicted 1338
2 SASI_Mm02_00305007 predicted 1229
3 SASI_Mm02_00305008 predicted 840
4 SASI_Mm02_00305009 predicted 1228
5 SASI_Mm02_00305010 predicted 815
6 SASI_Mm02_00305011 predicted 1358
7 SASI_Mm02_00305012 predicted 653
8 SASI_Mm02_00305013 predicted 1460
9 SASI_Mm02_00305014 predicted 1543
10 SASI_Mm02_00305015 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346796 predicted 1341
2 SASI_Mm02_00346797 predicted 1229
3 SASI_Mm02_00346798 predicted 840
4 SASI_Mm02_00346799 predicted 1228
5 SASI_Mm02_00346800 predicted 821
6 SASI_Mm02_00346801 predicted 1356
7 SASI_Mm02_00346802 predicted 655
8 SASI_Mm02_00346803 predicted 1459
9 SASI_Mm02_00346804 predicted 1542
10 SASI_Mm02_00346805 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020700
VALIDATED
PPM1H MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1630s21c1
Sequence:CCGGTGGGCTCAGGAGACGACATTTCTCGAGAAATGTCGTCTCCTGAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1518s21c1
Sequence:CCGGCCTAACTGTGATCCAGATGATCTCGAGATCATCTGGATCACAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-961s21c1
Sequence:CCGGCCCTCATTGTGATTTGCCTTTCTCGAGAAAGGCAAATCACAATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-920s21c1
Sequence:CCGGACGAGAGAGGAGTTCATATAACTCGAGTTATATGAACTCCTCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1955s21c1
Sequence:CCGGCCGAGGTGGCCATTGACTATTCTCGAGAATAGTCAATGGCCACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020700
VALIDATED
PPM1H MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1630s21c1
Sequence:CCGGTGGGCTCAGGAGACGACATTTCTCGAGAAATGTCGTCTCCTGAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1518s21c1
Sequence:CCGGCCTAACTGTGATCCAGATGATCTCGAGATCATCTGGATCACAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-961s21c1
Sequence:CCGGCCCTCATTGTGATTTGCCTTTCTCGAGAAAGGCAAATCACAATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-920s21c1
Sequence:CCGGACGAGAGAGGAGTTCATATAACTCGAGTTATATGAACTCCTCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1955s21c1
Sequence:CCGGCCGAGGTGGCCATTGACTATTCTCGAGAATAGTCAATGGCCACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020700
VALIDATED
PPM1H MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1630s21c1
Sequence:CCGGTGGGCTCAGGAGACGACATTTCTCGAGAAATGTCGTCTCCTGAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1518s21c1
Sequence:CCGGCCTAACTGTGATCCAGATGATCTCGAGATCATCTGGATCACAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-961s21c1
Sequence:CCGGCCCTCATTGTGATTTGCCTTTCTCGAGAAAGGCAAATCACAATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-920s21c1
Sequence:CCGGACGAGAGAGGAGTTCATATAACTCGAGTTATATGAACTCCTCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020700.1-1955s21c1
Sequence:CCGGCCGAGGTGGCCATTGACTATTCTCGAGAATAGTCAATGGCCACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176919
PPM1H MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000081136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-938s1c1
Sequence:CCGGGCGAGAGGAGTGCGTATAATACTCGAGTATTATACGCACTCCTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176919.2-1917s1c1
Sequence:CCGGGCTACATGAAACCCTATTTAACTCGAGTTAAATAGGGTTTCATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-1303s1c1
Sequence:CCGGGCCCGAGTAATGGCAACTATTCTCGAGAATAGTTGCCATTACTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-1555s1c1
Sequence:CCGGCCTCACAGGTTTGTGCCTTTACTCGAGTAAAGGCACAAACCTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176919
PPM1H MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000081136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-938s1c1
Sequence:CCGGGCGAGAGGAGTGCGTATAATACTCGAGTATTATACGCACTCCTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176919.2-1917s1c1
Sequence:CCGGGCTACATGAAACCCTATTTAACTCGAGTTAAATAGGGTTTCATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-1303s1c1
Sequence:CCGGGCCCGAGTAATGGCAACTATTCTCGAGAATAGTTGCCATTACTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-1555s1c1
Sequence:CCGGCCTCACAGGTTTGTGCCTTTACTCGAGTAAAGGCACAAACCTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176919
PPM1H MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000081136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-938s1c1
Sequence:CCGGGCGAGAGGAGTGCGTATAATACTCGAGTATTATACGCACTCCTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176919.2-1917s1c1
Sequence:CCGGGCTACATGAAACCCTATTTAACTCGAGTTAAATAGGGTTTCATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-1303s1c1
Sequence:CCGGGCCCGAGTAATGGCAACTATTCTCGAGAATAGTTGCCATTACTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176919.2-1555s1c1
Sequence:CCGGCCTCACAGGTTTGTGCCTTTACTCGAGTAAAGGCACAAACCTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_350880
VALIDATED
PPM1H MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_350880.3-1280s1c1
Sequence:CCGGGCAGGGCCATAATCATCAGAACTCGAGTTCTGATGATTATGGCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1783s1c1
Sequence:CCGGCCTAACTGTGATCCAGATGATCTCGAGATCATCTGGATCACAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1443s1c1
Sequence:CCGGGCTTGGAAAGAAGATGCTCTACTCGAGTAGAGCATCTTCTTTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1226s1c1
Sequence:CCGGCCCTCATTGTGATTTGCCTTTCTCGAGAAAGGCAAATCACAATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_350880.3-753s1c1
Sequence:CCGGCCCAAACAGGAACTCATCCAACTCGAGTTGGATGAGTTCCTGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_350880
VALIDATED
PPM1H MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_350880.3-1280s1c1
Sequence:CCGGGCAGGGCCATAATCATCAGAACTCGAGTTCTGATGATTATGGCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1783s1c1
Sequence:CCGGCCTAACTGTGATCCAGATGATCTCGAGATCATCTGGATCACAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1443s1c1
Sequence:CCGGGCTTGGAAAGAAGATGCTCTACTCGAGTAGAGCATCTTCTTTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1226s1c1
Sequence:CCGGCCCTCATTGTGATTTGCCTTTCTCGAGAAAGGCAAATCACAATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_350880.3-753s1c1
Sequence:CCGGCCCAAACAGGAACTCATCCAACTCGAGTTGGATGAGTTCCTGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_350880
VALIDATED
PPM1H MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1H
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_350880.3-1280s1c1
Sequence:CCGGGCAGGGCCATAATCATCAGAACTCGAGTTCTGATGATTATGGCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1783s1c1
Sequence:CCGGCCTAACTGTGATCCAGATGATCTCGAGATCATCTGGATCACAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1443s1c1
Sequence:CCGGGCTTGGAAAGAAGATGCTCTACTCGAGTAGAGCATCTTCTTTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_350880.3-1226s1c1
Sequence:CCGGCCCTCATTGTGATTTGCCTTTCTCGAGAAAGGCAAATCACAATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_350880.3-753s1c1
Sequence:CCGGCCCAAACAGGAACTCATCCAACTCGAGTTGGATGAGTTCCTGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)