EMAIL THIS PAGE TO A FRIEND

PPM1J

protein phosphatase, Mg2+/Mn2+ dependent, 1J

60 Gene Product Result for
Synonyms: PP2CZ PP2Czeta PPP2CZ
UniProtKB ID: Q5JR12, B3KSB7, Q6DKJ7, Q96EZ7, Q9UF84
Gene ID:
Human(333926) Summary: This gene encodes the serine/threonine protein phosphatase. The mouse homolog of this gene apparently belongs to the protein phosphatase 2C family of genes. The exact function of this gene is not yet known. [provided by RefSeq, Jul 2008]
Mouse(71887) protein phosphatase 1J
Rat(295341) protein phosphatase, Mg2+/Mn2+ dependent, 1J
chicken(419873) protein phosphatase, Mg2+/Mn2+ dependent, 1J
domestic cat(101098562) protein phosphatase, Mg2+/Mn2+ dependent, 1J
dog(483217) protein phosphatase, Mg2+/Mn2+ dependent, 1J
naked mole-rat(101708103) protein phosphatase, Mg2+/Mn2+ dependent, 1J
domestic guinea pig(100715843) protein phosphatase, Mg2+/Mn2+ dependent, 1J
cow(100848925) protein phosphatase, Mg2+/Mn2+ dependent, 1J
sheep(101107494) protein phosphatase, Mg2+/Mn2+ dependent, 1J
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005167 Rosetta Predictions human pricing
NM_001005540 Rosetta Predictions rat pricing
NM_027982 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032969 predicted 1244
2 SASI_Hs01_00032970 predicted 851
3 SASI_Hs01_00032971 predicted 1171
4 SASI_Hs02_00339111 predicted 387
5 SASI_Hs01_00032972 predicted 923
6 SASI_Hs01_00032973 predicted 362
7 SASI_Hs01_00032974 predicted 332
8 SASI_Hs01_00032975 predicted 1228
9 SASI_Hs01_00032976 predicted 897
10 SASI_Hs02_00339112 predicted 1301
11 SASI_Hs01_00032977 predicted 377
12 SASI_Hs01_00032978 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065589 predicted 538
2 SASI_Rn01_00065590 predicted 1344
3 SASI_Rn02_00198395 predicted 1218
4 SASI_Rn01_00065592 predicted 1464
5 SASI_Rn01_00065593 predicted 1166
6 SASI_Rn01_00065594 predicted 532
7 SASI_Rn01_00065595 predicted 1150
8 SASI_Rn01_00065596 predicted 866
9 SASI_Rn01_00065597 predicted 692
10 SASI_Rn01_00065598 predicted 938
11 SASI_Rn01_00065591 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055966 predicted 571
2 SASI_Mm01_00055967 predicted 1384
3 SASI_Mm01_00055968 predicted 1250
4 SASI_Mm01_00055969 predicted 989
5 SASI_Mm02_00333031 predicted 571
6 SASI_Mm01_00055971 predicted 1230
7 SASI_Mm01_00055973 predicted 457
8 SASI_Mm01_00055975 predicted 373
9 SASI_Mm02_00333032 predicted 1250
10 SASI_Mm02_00333033 predicted 716
11 SASI_Mm01_00055970 predicted 1291
12 SASI_Mm01_00055972 predicted 1191
13 SASI_Mm01_00055974 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005167
VALIDATED
PPM1J MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1J
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-1649s1c1
Sequence:CCGGGAATGGTGAAATCATTCCAATCTCGAGATTGGAATGATTTCACCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005167.4-2088s1c1
Sequence:CCGGGTCACTACTGACTGTGAGGTACTCGAGTACCTCACAGTCAGTAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-2013s1c1
Sequence:CCGGCGAGTGTATGACCTGACACAACTCGAGTTGTGTCAGGTCATACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-2145s1c1
Sequence:CCGGCCTAATGACCACAGCAGGTATCTCGAGATACCTGCTGTGGTCATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005167.4-1578s1c1
Sequence:CCGGCTGGTTGTGATCTACCTGCTACTCGAGTAGCAGGTAGATCACAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-1367s21c1
Sequence:GTACCGGTGTCGGCCTATGAGCCTAATGCTCGAGCATTAGGCTCATAGGCCGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-1324s21c1
Sequence:CCGGGTCACTACTGACTGTGAGGTACTCGAGTACCTCACAGTCAGTAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-814s21c1
Sequence:CCGGCTGGTTGTGATCTACCTGCTACTCGAGTAGCAGGTAGATCACAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-553s21c1
Sequence:CCGGCATATCCGAGAGCAGCTAAAGCTCGAGCTTTAGCTGCTCTCGGATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005167.5-1578s21c1
Sequence:GTACCGGCCATACTTACTCCTCTCACAGCTCGAGCTGTGAGAGGAGTAAGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-395s21c1
Sequence:CCGGCTTGCTGTGAAGTGGTGTATGCTCGAGCATACACCACTTCACAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005167.5-1567s21c1
Sequence:CCGGCACTAGCCTCTCCATACTTACCTCGAGGTAAGTATGGAGAGGCTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005167
VALIDATED
PPM1J MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1J
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-1649s1c1
Sequence:CCGGGAATGGTGAAATCATTCCAATCTCGAGATTGGAATGATTTCACCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005167.4-2088s1c1
Sequence:CCGGGTCACTACTGACTGTGAGGTACTCGAGTACCTCACAGTCAGTAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-2013s1c1
Sequence:CCGGCGAGTGTATGACCTGACACAACTCGAGTTGTGTCAGGTCATACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-2145s1c1
Sequence:CCGGCCTAATGACCACAGCAGGTATCTCGAGATACCTGCTGTGGTCATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005167.4-1578s1c1
Sequence:CCGGCTGGTTGTGATCTACCTGCTACTCGAGTAGCAGGTAGATCACAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-1367s21c1
Sequence:GTACCGGTGTCGGCCTATGAGCCTAATGCTCGAGCATTAGGCTCATAGGCCGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-1324s21c1
Sequence:CCGGGTCACTACTGACTGTGAGGTACTCGAGTACCTCACAGTCAGTAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-814s21c1
Sequence:CCGGCTGGTTGTGATCTACCTGCTACTCGAGTAGCAGGTAGATCACAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-553s21c1
Sequence:CCGGCATATCCGAGAGCAGCTAAAGCTCGAGCTTTAGCTGCTCTCGGATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005167.5-1578s21c1
Sequence:GTACCGGCCATACTTACTCCTCTCACAGCTCGAGCTGTGAGAGGAGTAAGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-395s21c1
Sequence:CCGGCTTGCTGTGAAGTGGTGTATGCTCGAGCATACACCACTTCACAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005167.5-1567s21c1
Sequence:CCGGCACTAGCCTCTCCATACTTACCTCGAGGTAAGTATGGAGAGGCTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005167
VALIDATED
PPM1J MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1J
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-1649s1c1
Sequence:CCGGGAATGGTGAAATCATTCCAATCTCGAGATTGGAATGATTTCACCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005167.4-2088s1c1
Sequence:CCGGGTCACTACTGACTGTGAGGTACTCGAGTACCTCACAGTCAGTAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-2013s1c1
Sequence:CCGGCGAGTGTATGACCTGACACAACTCGAGTTGTGTCAGGTCATACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005167.4-2145s1c1
Sequence:CCGGCCTAATGACCACAGCAGGTATCTCGAGATACCTGCTGTGGTCATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005167.4-1578s1c1
Sequence:CCGGCTGGTTGTGATCTACCTGCTACTCGAGTAGCAGGTAGATCACAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-1367s21c1
Sequence:GTACCGGTGTCGGCCTATGAGCCTAATGCTCGAGCATTAGGCTCATAGGCCGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-1324s21c1
Sequence:CCGGGTCACTACTGACTGTGAGGTACTCGAGTACCTCACAGTCAGTAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-814s21c1
Sequence:CCGGCTGGTTGTGATCTACCTGCTACTCGAGTAGCAGGTAGATCACAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-553s21c1
Sequence:CCGGCATATCCGAGAGCAGCTAAAGCTCGAGCTTTAGCTGCTCTCGGATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005167.5-1578s21c1
Sequence:GTACCGGCCATACTTACTCCTCTCACAGCTCGAGCTGTGAGAGGAGTAAGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005167.5-395s21c1
Sequence:CCGGCTTGCTGTGAAGTGGTGTATGCTCGAGCATACACCACTTCACAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005167.5-1567s21c1
Sequence:CCGGCACTAGCCTCTCCATACTTACCTCGAGGTAAGTATGGAGAGGCTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027982
PPM1J MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1J
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-573s1c1
Sequence:CCGGAGCTCAAGGATCTAGTAGAAACTCGAGTTTCTACTAGATCCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-402s1c1
Sequence:CCGGGCGAGGTTGTGTATGTGGAAACTCGAGTTTCCACATACACAACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-144s1c1
Sequence:CCGGCCCAAGAAACACCTAAGAGTTCTCGAGAACTCTTAGGTGTTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-657s1c1
Sequence:CCGGCCAGTCCTTCACAGTTGGTTACTCGAGTAACCAACTGTGAAGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-1247s1c1
Sequence:CCGGCCTGAAGTACGAGTGTATGATCTCGAGATCATACACTCGTACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027982
PPM1J MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1J
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-573s1c1
Sequence:CCGGAGCTCAAGGATCTAGTAGAAACTCGAGTTTCTACTAGATCCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-402s1c1
Sequence:CCGGGCGAGGTTGTGTATGTGGAAACTCGAGTTTCCACATACACAACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-144s1c1
Sequence:CCGGCCCAAGAAACACCTAAGAGTTCTCGAGAACTCTTAGGTGTTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-657s1c1
Sequence:CCGGCCAGTCCTTCACAGTTGGTTACTCGAGTAACCAACTGTGAAGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-1247s1c1
Sequence:CCGGCCTGAAGTACGAGTGTATGATCTCGAGATCATACACTCGTACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027982
PPM1J MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1J
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-573s1c1
Sequence:CCGGAGCTCAAGGATCTAGTAGAAACTCGAGTTTCTACTAGATCCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-402s1c1
Sequence:CCGGGCGAGGTTGTGTATGTGGAAACTCGAGTTTCCACATACACAACCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-144s1c1
Sequence:CCGGCCCAAGAAACACCTAAGAGTTCTCGAGAACTCTTAGGTGTTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-657s1c1
Sequence:CCGGCCAGTCCTTCACAGTTGGTTACTCGAGTAACCAACTGTGAAGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027982.1-1247s1c1
Sequence:CCGGCCTGAAGTACGAGTGTATGATCTCGAGATCATACACTCGTACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)