EMAIL THIS PAGE TO A FRIEND

PPM1L

protein phosphatase, Mg2+/Mn2+ dependent, 1L

126 Gene Product Result for
Synonyms: PP2C-epsilon PP2CE PPM1-LIKE
UniProtKB ID: Q5SGD2, Q2M3J2, Q96NM7
Gene ID:
Human(151742) Summary: PPM1L, or PP2CE, belongs to the PP2C group of serine/threonine phosphatases, which are distinguished from other phosphatases by their structure, absolute requirement for Mg(2+) or Mn(2+), and insensitivity to okadaic acid. PP2Cs regulate stress-activated protein kinase (SAPK; see MIM 601158) signaling cascades that respond to extracellular stimuli (Jin et al., 2004 [PubMed 15560375]
Mouse(242083) protein phosphatase 1 (formerly 2C)-like
Rat(310506) protein phosphatase, Mg2+/Mn2+ dependent, 1L
chicken(429162) protein phosphatase, Mg2+/Mn2+ dependent, 1L
dog(608708) protein phosphatase, Mg2+/Mn2+ dependent, 1L
domestic cat(101092959) protein phosphatase, Mg2+/Mn2+ dependent, 1L
naked mole-rat(101705935) protein phosphatase, Mg2+/Mn2+ dependent, 1L
domestic guinea pig(100729568) protein phosphatase, Mg2+/Mn2+ dependent, 1L
cow(541235) protein phosphatase, Mg2+/Mn2+ dependent, 1L
sheep(101105045) protein phosphatase, Mg2+/Mn2+ dependent, 1L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137701 MISSION® esiRNA esiRNA human PPM1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139245 Rosetta Predictions human pricing
NM_001107681 Rosetta Predictions rat pricing
NM_178726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139729 predicted 1113
2 SASI_Hs01_00139730 predicted 533
3 SASI_Hs01_00139731 predicted 951
4 SASI_Hs02_00364249 predicted 764
5 SASI_Hs01_00139732 predicted 780
6 SASI_Hs01_00139733 predicted 936
7 SASI_Hs01_00139734 predicted 1216
8 SASI_Hs01_00139735 predicted 1026
9 SASI_Hs01_00139736 predicted 1255
10 SASI_Hs01_00139737 predicted 587
11 SASI_Hs01_00139738 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231225 predicted 1169
2 SASI_Rn02_00231226 predicted 242
3 SASI_Rn02_00231227 predicted 1209
4 SASI_Rn02_00231228 predicted 482
5 SASI_Rn02_00231229 predicted 1159
6 SASI_Rn02_00231230 predicted 362
7 SASI_Rn02_00231231 predicted 1147
8 SASI_Rn02_00231232 predicted 354
9 SASI_Rn02_00231233 predicted 970
10 SASI_Rn02_00231234 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165378 predicted 851
2 SASI_Mm02_00349254 predicted 1808
3 SASI_Mm01_00165379 predicted 1765
4 SASI_Mm01_00165380 predicted 1748
5 SASI_Mm01_00165381 predicted 772
6 SASI_Mm01_00165382 predicted 969
7 SASI_Mm01_00165383 predicted 1524
8 SASI_Mm01_00165386 predicted 960
9 SASI_Mm01_00165387 predicted 897
10 SASI_Mm02_00349255 predicted 1229
11 SASI_Mm01_00165384 predicted 1106
12 SASI_Mm01_00165385 predicted 1688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139245
PPM1L MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1L
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139245.x-2632s1c1
Sequence:CCGGCCCATGAGATTTGCTTACTTTCTCGAGAAAGTAAGCAAATCTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-361s1c1
Sequence:CCGGACGTGTTTGATTGCTCTGCTACTCGAGTAGCAGAGCAATCAAACACGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-362s1c1
Sequence:CCGGCGTGTTTGATTGCTCTGCTATCTCGAGATAGCAGAGCAATCAAACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-516s1c1
Sequence:CCGGAGGTGGTTTCATCAGTTTCAACTCGAGTTGAAACTGATGAAACCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-434s1c1
Sequence:CCGGGTGACAAAGATGGGAACGCTACTCGAGTAGCGTTCCCATCTTTGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139245.2-1308s21c1
Sequence:CCGGCCTGGTGGTCTTAGGTCTATACTCGAGTATAGACCTAAGACCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139245.2-550s21c1
Sequence:CCGGATCTTCAGGACTACGAGAAAGCTCGAGCTTTCTCGTAGTCCTGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139245.2-1197s21c1
Sequence:CCGGTCTCAGCTGCCTTAGACTAAACTCGAGTTTAGTCTAAGGCAGCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139245.2-689s21c1
Sequence:CCGGGATTGCTCTGCTATCAGATAACTCGAGTTATCTGATAGCAGAGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139245
PPM1L MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1L
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139245.x-2632s1c1
Sequence:CCGGCCCATGAGATTTGCTTACTTTCTCGAGAAAGTAAGCAAATCTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-361s1c1
Sequence:CCGGACGTGTTTGATTGCTCTGCTACTCGAGTAGCAGAGCAATCAAACACGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-362s1c1
Sequence:CCGGCGTGTTTGATTGCTCTGCTATCTCGAGATAGCAGAGCAATCAAACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-516s1c1
Sequence:CCGGAGGTGGTTTCATCAGTTTCAACTCGAGTTGAAACTGATGAAACCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-434s1c1
Sequence:CCGGGTGACAAAGATGGGAACGCTACTCGAGTAGCGTTCCCATCTTTGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139245.2-1308s21c1
Sequence:CCGGCCTGGTGGTCTTAGGTCTATACTCGAGTATAGACCTAAGACCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139245.2-550s21c1
Sequence:CCGGATCTTCAGGACTACGAGAAAGCTCGAGCTTTCTCGTAGTCCTGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139245.2-1197s21c1
Sequence:CCGGTCTCAGCTGCCTTAGACTAAACTCGAGTTTAGTCTAAGGCAGCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139245.2-689s21c1
Sequence:CCGGGATTGCTCTGCTATCAGATAACTCGAGTTATCTGATAGCAGAGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139245
PPM1L MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1L
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139245.x-2632s1c1
Sequence:CCGGCCCATGAGATTTGCTTACTTTCTCGAGAAAGTAAGCAAATCTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-361s1c1
Sequence:CCGGACGTGTTTGATTGCTCTGCTACTCGAGTAGCAGAGCAATCAAACACGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-362s1c1
Sequence:CCGGCGTGTTTGATTGCTCTGCTATCTCGAGATAGCAGAGCAATCAAACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-516s1c1
Sequence:CCGGAGGTGGTTTCATCAGTTTCAACTCGAGTTGAAACTGATGAAACCACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139245.x-434s1c1
Sequence:CCGGGTGACAAAGATGGGAACGCTACTCGAGTAGCGTTCCCATCTTTGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139245.2-1308s21c1
Sequence:CCGGCCTGGTGGTCTTAGGTCTATACTCGAGTATAGACCTAAGACCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139245.2-550s21c1
Sequence:CCGGATCTTCAGGACTACGAGAAAGCTCGAGCTTTCTCGTAGTCCTGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139245.2-1197s21c1
Sequence:CCGGTCTCAGCTGCCTTAGACTAAACTCGAGTTTAGTCTAAGGCAGCTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139245.2-689s21c1
Sequence:CCGGGATTGCTCTGCTATCAGATAACTCGAGTTATCTGATAGCAGAGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178726
VALIDATED
PPM1L MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1L
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1934s1c1
Sequence:CCGGCCCTTCTATCAGTGTTTGAAACTCGAGTTTCAAACACTGATAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1575s1c1
Sequence:CCGGGCAATGAAGAAGCGGTTCGATCTCGAGATCGAACCGCTTCTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1209s1c1
Sequence:CCGGCCTATGATGAAGCAGGCACAACTCGAGTTGTGCCTGCTTCATCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-839s1c1
Sequence:CCGGGCCGAGATTATGCAGAACGATCTCGAGATCGTTCTGCATAATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1010s1c1
Sequence:CCGGCCGTCCATCTTCGGAATCTTTCTCGAGAAAGATTCCGAAGATGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178726
VALIDATED
PPM1L MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1L
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1934s1c1
Sequence:CCGGCCCTTCTATCAGTGTTTGAAACTCGAGTTTCAAACACTGATAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1575s1c1
Sequence:CCGGGCAATGAAGAAGCGGTTCGATCTCGAGATCGAACCGCTTCTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1209s1c1
Sequence:CCGGCCTATGATGAAGCAGGCACAACTCGAGTTGTGCCTGCTTCATCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-839s1c1
Sequence:CCGGGCCGAGATTATGCAGAACGATCTCGAGATCGTTCTGCATAATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1010s1c1
Sequence:CCGGCCGTCCATCTTCGGAATCTTTCTCGAGAAAGATTCCGAAGATGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178726
VALIDATED
PPM1L MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1L
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1934s1c1
Sequence:CCGGCCCTTCTATCAGTGTTTGAAACTCGAGTTTCAAACACTGATAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1575s1c1
Sequence:CCGGGCAATGAAGAAGCGGTTCGATCTCGAGATCGAACCGCTTCTTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1209s1c1
Sequence:CCGGCCTATGATGAAGCAGGCACAACTCGAGTTGTGCCTGCTTCATCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-839s1c1
Sequence:CCGGGCCGAGATTATGCAGAACGATCTCGAGATCGTTCTGCATAATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178726.2-1010s1c1
Sequence:CCGGCCGTCCATCTTCGGAATCTTTCTCGAGAAAGATTCCGAAGATGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)