EMAIL THIS PAGE TO A FRIEND

PPM1M

protein phosphatase, Mg2+/Mn2+ dependent, 1M

102 Gene Product Result for
Synonyms: PP2C-eta PP2CE PP2Ceta
UniProtKB ID: Q96MI6, Q8N8J9, Q96DB8
Gene ID:
Mouse(67905) protein phosphatase 1M
Rat(686298) protein phosphatase, Mg2+/Mn2+ dependent, 1M
chicken(415941) protein phosphatase, Mg2+/Mn2+ dependent, 1M
dog(484739) protein phosphatase, Mg2+/Mn2+ dependent, 1M
domestic cat(101092423) protein phosphatase, Mg2+/Mn2+ dependent, 1M
cow(510238) protein phosphatase, Mg2+/Mn2+ dependent, 1M
sheep(101112354) protein phosphatase, Mg2+/Mn2+ dependent, 1M
domestic guinea pig(100715165) protein phosphatase, Mg2+/Mn2+ dependent, 1M
naked mole-rat(101704234) protein phosphatase, Mg2+/Mn2+ dependent, 1M
Domestic Rabbit(100345502) protein phosphatase, Mg2+/Mn2+ dependent, 1M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122870 Rosetta Predictions human pricing
NM_144641 Rosetta Predictions human pricing
XM_001073372 Rosetta Predictions rat pricing
NM_026447 Rosetta Predictions mouse pricing
NM_198931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327527 predicted 1332
2 SASI_Hs02_00327528 predicted 1225
3 SASI_Hs02_00327529 predicted 1371
4 SASI_Hs02_00327530 predicted 554
5 SASI_Hs02_00327531 predicted 1171
6 SASI_Hs02_00327532 predicted 426
7 SASI_Hs02_00327533 predicted 681
8 SASI_Hs02_00327534 predicted 1128
9 SASI_Hs02_00327535 predicted 1407
10 SASI_Hs02_00327536 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364484 predicted 1591
2 SASI_Hs02_00364485 predicted 1480
3 SASI_Hs02_00364486 predicted 1625
4 SASI_Hs01_00084976 predicted 806
5 SASI_Hs02_00364487 predicted 1431
6 SASI_Hs02_00364488 predicted 689
7 SASI_Hs01_00084982 predicted 934
8 SASI_Hs02_00364489 predicted 1383
9 SASI_Hs02_00364490 predicted 1659
10 SASI_Hs01_00084983 predicted 836
11 SASI_Hs01_00084974 predicted 1205
12 SASI_Hs01_00084975 predicted 1416
13 SASI_Hs01_00084977 predicted 1631
14 SASI_Hs01_00084978 predicted 1601
15 SASI_Hs01_00084979 predicted 1641
16 SASI_Hs01_00084980 predicted 1610
17 SASI_Hs01_00084981 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342545 predicted 988
2 SASI_Rn02_00342546 predicted 1723
3 SASI_Rn02_00342547 predicted 1063
4 SASI_Rn02_00342548 predicted 604
5 SASI_Rn02_00342549 predicted 1122
6 SASI_Rn02_00342550 predicted 2205
7 SASI_Rn02_00342551 predicted 2008
8 SASI_Rn02_00342552 predicted 1710
9 SASI_Rn02_00342553 predicted 2161
10 SASI_Rn02_00342554 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026235 predicted 818
2 SASI_Mm01_00026237 predicted 632
3 SASI_Mm01_00026238 predicted 877
4 SASI_Mm02_00330279 predicted 1429
5 SASI_Mm01_00026239 predicted 1276
6 SASI_Mm01_00026240 predicted 1345
7 SASI_Mm02_00330280 predicted 1228
8 SASI_Mm01_00026241 predicted 617
9 SASI_Mm01_00026243 predicted 1470
10 SASI_Mm01_00026244 predicted 1239
11 SASI_Mm01_00026236 predicted 1319
12 SASI_Mm01_00026242 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038112 predicted 823
2 SASI_Mm01_00038114 predicted 635
3 SASI_Mm01_00038115 predicted 882
4 SASI_Mm02_00351218 predicted 1436
5 SASI_Mm01_00038116 predicted 1275
6 SASI_Mm01_00038117 predicted 1355
7 SASI_Mm02_00351219 predicted 1227
8 SASI_Mm01_00038118 predicted 622
9 SASI_Mm01_00038120 predicted 1474
10 SASI_Mm01_00038121 predicted 1245
11 SASI_Mm01_00038113 predicted 1290
12 SASI_Mm01_00038119 predicted 1317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144641
VALIDATED
PPM1M MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1M
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1107s21c1
Sequence:CCGGGACCCACACAGGTTCTCAAAGCTCGAGCTTTGAGAACCTGTGTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144641.2-1591s21c1
Sequence:CCGGGCACCCAAGCTAAGGGTATTACTCGAGTAATACCCTTAGCTTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144641.2-1560s21c1
Sequence:CCGGGAACAGCCCAAAGTATCATTCCTCGAGGAATGATACTTTGGGCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1260s21c1
Sequence:CCGGTGAGGATTCAGACACTGTATCCTCGAGGATACAGTGTCTGAATCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1204s21c1
Sequence:CCGGACGTCTCTGTGTTCGTGATTCCTCGAGGAATCACGAACACAGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_144641.x-1901s1c1
Sequence:CCGGCAACTTAACTAGGAAACCCATCTCGAGATGGGTTTCCTAGTTAAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-713s1c1
Sequence:CCGGGCTGGCCTTTGTCTATCCTGACTCGAGTCAGGATAGACAAAGGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-1070s1c1
Sequence:CCGGTGATGGACTCTGGGATGTACTCTCGAGAGTACATCCCAGAGTCCATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-842s1c1
Sequence:CCGGCAAACGTGTGGAGAAATCGGACTCGAGTCCGATTTCTCCACACGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144641
VALIDATED
PPM1M MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1M
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1107s21c1
Sequence:CCGGGACCCACACAGGTTCTCAAAGCTCGAGCTTTGAGAACCTGTGTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144641.2-1591s21c1
Sequence:CCGGGCACCCAAGCTAAGGGTATTACTCGAGTAATACCCTTAGCTTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144641.2-1560s21c1
Sequence:CCGGGAACAGCCCAAAGTATCATTCCTCGAGGAATGATACTTTGGGCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1260s21c1
Sequence:CCGGTGAGGATTCAGACACTGTATCCTCGAGGATACAGTGTCTGAATCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1204s21c1
Sequence:CCGGACGTCTCTGTGTTCGTGATTCCTCGAGGAATCACGAACACAGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_144641.x-1901s1c1
Sequence:CCGGCAACTTAACTAGGAAACCCATCTCGAGATGGGTTTCCTAGTTAAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-713s1c1
Sequence:CCGGGCTGGCCTTTGTCTATCCTGACTCGAGTCAGGATAGACAAAGGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-1070s1c1
Sequence:CCGGTGATGGACTCTGGGATGTACTCTCGAGAGTACATCCCAGAGTCCATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-842s1c1
Sequence:CCGGCAAACGTGTGGAGAAATCGGACTCGAGTCCGATTTCTCCACACGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144641
VALIDATED
PPM1M MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1M
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1107s21c1
Sequence:CCGGGACCCACACAGGTTCTCAAAGCTCGAGCTTTGAGAACCTGTGTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144641.2-1591s21c1
Sequence:CCGGGCACCCAAGCTAAGGGTATTACTCGAGTAATACCCTTAGCTTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144641.2-1560s21c1
Sequence:CCGGGAACAGCCCAAAGTATCATTCCTCGAGGAATGATACTTTGGGCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1260s21c1
Sequence:CCGGTGAGGATTCAGACACTGTATCCTCGAGGATACAGTGTCTGAATCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144641.2-1204s21c1
Sequence:CCGGACGTCTCTGTGTTCGTGATTCCTCGAGGAATCACGAACACAGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_144641.x-1901s1c1
Sequence:CCGGCAACTTAACTAGGAAACCCATCTCGAGATGGGTTTCCTAGTTAAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-713s1c1
Sequence:CCGGGCTGGCCTTTGTCTATCCTGACTCGAGTCAGGATAGACAAAGGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-1070s1c1
Sequence:CCGGTGATGGACTCTGGGATGTACTCTCGAGAGTACATCCCAGAGTCCATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144641.x-842s1c1
Sequence:CCGGCAAACGTGTGGAGAAATCGGACTCGAGTCCGATTTCTCCACACGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026447
VALIDATED
PPM1M MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1M
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026447.4-1671s21c1
Sequence:CCGGTCTGGGTCCAACTCGTGAAATCTCGAGATTTCACGAGTTGGACCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026447.4-399s21c1
Sequence:CCGGGTCACTACTGGGCACTGTTTGCTCGAGCAAACAGTGCCCAGTAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-1309s21c1
Sequence:CCGGGATACACAACACTCAAGGAAACTCGAGTTTCCTTGAGTGTTGTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-1365s21c1
Sequence:CCGGACGACGATGTCTCCGTGTTTGCTCGAGCAAACACGGAGACATCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-634s21c3
Sequence:CCGGCCAGGAATGTGATGATGTGATCTCGAGATCACATCATCACATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026447.2-1620s1c1
Sequence:CCGGCAGAGGTACTTGATAGCACATCTCGAGATGTGCTATCAAGTACCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-1347s1c1
Sequence:CCGGGATACACAACACTCAAGGAAACTCGAGTTTCCTTGAGTGTTGTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-1211s1c1
Sequence:CCGGAGGATGTGGTTGTCATGGCAACTCGAGTTGCCATGACAACCACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026447.2-1037s1c1
Sequence:CCGGCACTGATTCATGGACAGGGTACTCGAGTACCCTGTCCATGAATCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-672s1c1
Sequence:CCGGCCAGGAATGTGATGATGTGATCTCGAGATCACATCATCACATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026447
VALIDATED
PPM1M MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1M
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026447.4-1671s21c1
Sequence:CCGGTCTGGGTCCAACTCGTGAAATCTCGAGATTTCACGAGTTGGACCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026447.4-399s21c1
Sequence:CCGGGTCACTACTGGGCACTGTTTGCTCGAGCAAACAGTGCCCAGTAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-1309s21c1
Sequence:CCGGGATACACAACACTCAAGGAAACTCGAGTTTCCTTGAGTGTTGTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-1365s21c1
Sequence:CCGGACGACGATGTCTCCGTGTTTGCTCGAGCAAACACGGAGACATCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-634s21c3
Sequence:CCGGCCAGGAATGTGATGATGTGATCTCGAGATCACATCATCACATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026447.2-1620s1c1
Sequence:CCGGCAGAGGTACTTGATAGCACATCTCGAGATGTGCTATCAAGTACCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-1347s1c1
Sequence:CCGGGATACACAACACTCAAGGAAACTCGAGTTTCCTTGAGTGTTGTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-1211s1c1
Sequence:CCGGAGGATGTGGTTGTCATGGCAACTCGAGTTGCCATGACAACCACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026447.2-1037s1c1
Sequence:CCGGCACTGATTCATGGACAGGGTACTCGAGTACCCTGTCCATGAATCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-672s1c1
Sequence:CCGGCCAGGAATGTGATGATGTGATCTCGAGATCACATCATCACATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026447
VALIDATED
PPM1M MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1M
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026447.4-1671s21c1
Sequence:CCGGTCTGGGTCCAACTCGTGAAATCTCGAGATTTCACGAGTTGGACCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026447.4-399s21c1
Sequence:CCGGGTCACTACTGGGCACTGTTTGCTCGAGCAAACAGTGCCCAGTAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-1309s21c1
Sequence:CCGGGATACACAACACTCAAGGAAACTCGAGTTTCCTTGAGTGTTGTGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-1365s21c1
Sequence:CCGGACGACGATGTCTCCGTGTTTGCTCGAGCAAACACGGAGACATCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026447.4-634s21c3
Sequence:CCGGCCAGGAATGTGATGATGTGATCTCGAGATCACATCATCACATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026447.2-1620s1c1
Sequence:CCGGCAGAGGTACTTGATAGCACATCTCGAGATGTGCTATCAAGTACCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-1347s1c1
Sequence:CCGGGATACACAACACTCAAGGAAACTCGAGTTTCCTTGAGTGTTGTGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-1211s1c1
Sequence:CCGGAGGATGTGGTTGTCATGGCAACTCGAGTTGCCATGACAACCACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026447.2-1037s1c1
Sequence:CCGGCACTGATTCATGGACAGGGTACTCGAGTACCCTGTCCATGAATCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026447.2-672s1c1
Sequence:CCGGCCAGGAATGTGATGATGTGATCTCGAGATCACATCATCACATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)