EMAIL THIS PAGE TO A FRIEND

PPME1

protein phosphatase methylesterase 1

154 Gene Product Result for
Synonyms: PME-1
UniProtKB ID: Q9Y570, B3KMU6, B5MEE7, Q8WYG8, Q9NVT5, Q9UI18
Gene ID:
Human(51400) Summary: This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Mouse(72590) protein phosphatase methylesterase 1
Rat(361613) protein phosphatase methylesterase 1
Thale Cress(843331) pectinesterase PPME1
domestic cat(101094949) protein phosphatase methylesterase 1
dog(612812) protein phosphatase methylesterase 1
chicken(419058) protein phosphatase methylesterase 1
Zebrafish(335124) protein phosphatase methylesterase 1
cow(535390) protein phosphatase methylesterase 1
sheep(101105849) protein phosphatase methylesterase 1
domestic guinea pig(100726445) protein phosphatase methylesterase 1
Domestic Rabbit(100358403) protein phosphatase methylesterase 1
naked mole-rat(101711871) protein phosphatase methylesterase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016147 siRNAs that have been validated in the lab human pricing
XM_001066863 Rosetta Predictions rat pricing
XM_341891 Rosetta Predictions rat pricing
NM_028292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016147 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018395 validated 648
2 SASI_Hs01_00018394 predicted 1021
3 SASI_Hs01_00018396 predicted 932
4 SASI_Hs01_00018397 predicted 887
5 SASI_Hs01_00018398 predicted 503
6 SASI_Hs01_00018399 predicted 1187
7 SASI_Hs01_00018400 predicted 662
8 SASI_Hs01_00018401 predicted 626
9 SASI_Hs01_00018402 predicted 417
10 SASI_Hs01_00018403 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318949 predicted 654
2 SASI_Rn02_00318950 predicted 616
3 SASI_Rn02_00318951 predicted 1228
4 SASI_Rn02_00318952 predicted 1161
5 SASI_Rn02_00318953 predicted 982
6 SASI_Rn02_00318954 predicted 1135
7 SASI_Rn02_00318955 predicted 1665
8 SASI_Rn02_00318956 predicted 1315
9 SASI_Rn02_00318957 predicted 761
10 SASI_Rn02_00318958 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149767 predicted 655
2 SASI_Rn01_00149768 predicted 622
3 SASI_Rn01_00149769 predicted 1227
4 SASI_Rn01_00149770 predicted 1166
5 SASI_Rn01_00149771 predicted 978
6 SASI_Rn01_00149772 predicted 1132
7 SASI_Rn01_00149773 predicted 1657
8 SASI_Rn01_00149774 predicted 1317
9 SASI_Rn01_00149775 predicted 761
10 SASI_Rn01_00149776 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146935 predicted 927
2 SASI_Mm01_00146936 predicted 244
3 SASI_Mm01_00146937 predicted 348
4 SASI_Mm02_00333644 predicted 1032
5 SASI_Mm01_00146938 predicted 639
6 SASI_Mm01_00146939 predicted 1158
7 SASI_Mm01_00146940 predicted 212
8 SASI_Mm01_00146941 predicted 694
9 SASI_Mm01_00146942 predicted 853
10 SASI_Mm01_00146943 predicted 815
11 SASI_Mm01_00146944 predicted 1261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016147
VALIDATED
PPME1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase methylesterase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016147.1-1285s21c1
Sequence:GTACCGGACATCGAGCTCTGTTGTAAATCTCGAGATTTACAACAGAGCTCGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-379s21c1
Sequence:CCGGGTGTTCACGGCAGCGATTATTCTCGAGAATAATCGCTGCCGTGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016147.1-1063s21c1
Sequence:CCGGGGTGTTGATAGATTGGATAAACTCGAGTTTATCCAATCTATCAACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-653s21c1
Sequence:CCGGGTACAGCTATGGATGCACTTACTCGAGTAAGTGCATCCATAGCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016147.1-1591s21c1
Sequence:CCGGGCGATACATCTGAGTTCAAATCTCGAGATTTGAACTCAGATGTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-532s21c1
Sequence:CCGGGACCTTCCTCCTCCAATTATGCTCGAGCATAATTGGAGGAGGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-388s1c1
Sequence:CCGGGCAGCGATTATTAGTAGAGTTCTCGAGAACTCTACTAATAATCGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-1010s1c1
Sequence:CCGGGCTTATCCAATCTCTTTCTTACTCGAGTAAGAAAGAGATTGGATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016147.x-1993s1c1
Sequence:CCGGCCCAGGTTAAATACAGCCCATCTCGAGATGGGCTGTATTTAACCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-653s1c1
Sequence:CCGGGTACAGCTATGGATGCACTTACTCGAGTAAGTGCATCCATAGCTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016147
VALIDATED
PPME1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase methylesterase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016147.1-1285s21c1
Sequence:GTACCGGACATCGAGCTCTGTTGTAAATCTCGAGATTTACAACAGAGCTCGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-379s21c1
Sequence:CCGGGTGTTCACGGCAGCGATTATTCTCGAGAATAATCGCTGCCGTGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016147.1-1063s21c1
Sequence:CCGGGGTGTTGATAGATTGGATAAACTCGAGTTTATCCAATCTATCAACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-653s21c1
Sequence:CCGGGTACAGCTATGGATGCACTTACTCGAGTAAGTGCATCCATAGCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016147.1-1591s21c1
Sequence:CCGGGCGATACATCTGAGTTCAAATCTCGAGATTTGAACTCAGATGTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-532s21c1
Sequence:CCGGGACCTTCCTCCTCCAATTATGCTCGAGCATAATTGGAGGAGGAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-388s1c1
Sequence:CCGGGCAGCGATTATTAGTAGAGTTCTCGAGAACTCTACTAATAATCGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-1010s1c1
Sequence:CCGGGCTTATCCAATCTCTTTCTTACTCGAGTAAGAAAGAGATTGGATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016147.x-1993s1c1
Sequence:CCGGCCCAGGTTAAATACAGCCCATCTCGAGATGGGCTGTATTTAACCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-653s1c1
Sequence:CCGGGTACAGCTATGGATGCACTTACTCGAGTAAGTGCATCCATAGCTGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016147
VALIDATED
PPME1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase methylesterase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016147.1-1285s21c1
Sequence:GTACCGGACATCGAGCTCTGTTGTAAATCTCGAGATTTACAACAGAGCTCGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-379s21c1
Sequence:CCGGGTGTTCACGGCAGCGATTATTCTCGAGAATAATCGCTGCCGTGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016147.1-1063s21c1
Sequence:CCGGGGTGTTGATAGATTGGATAAACTCGAGTTTATCCAATCTATCAACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-653s21c1
Sequence:CCGGGTACAGCTATGGATGCACTTACTCGAGTAAGTGCATCCATAGCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016147.1-1591s21c1
Sequence:CCGGGCGATACATCTGAGTTCAAATCTCGAGATTTGAACTCAGATGTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016147.1-532s21c1
Sequence:CCGGGACCTTCCTCCTCCAATTATGCTCGAGCATAATTGGAGGAGGAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-388s1c1
Sequence:CCGGGCAGCGATTATTAGTAGAGTTCTCGAGAACTCTACTAATAATCGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-1010s1c1
Sequence:CCGGGCTTATCCAATCTCTTTCTTACTCGAGTAAGAAAGAGATTGGATAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016147.x-1993s1c1
Sequence:CCGGCCCAGGTTAAATACAGCCCATCTCGAGATGGGCTGTATTTAACCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016147.x-653s1c1
Sequence:CCGGGTACAGCTATGGATGCACTTACTCGAGTAAGTGCATCCATAGCTGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028292
VALIDATED
PPME1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase methylesterase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-362s21c1
Sequence:CCGGGCAGCAATCATCAGTAGAGTACTCGAGTACTCTACTGATGATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-1034s21c1
Sequence:CCGGGCAGGTGTTGACAGATTGGATCTCGAGATCCAATCTGTCAACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-630s21c1
Sequence:CCGGCCGCCATGGATGCACTTAATACTCGAGTATTAAGTGCATCCATGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-693s21c1
Sequence:CCGGCTTTGGAGAATGCTATTGAATCTCGAGATTCAATAGCATTCTCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-1034s1c1
Sequence:CCGGGCAGGTGTTGACAGATTGGATCTCGAGATCCAATCTGTCAACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-693s1c1
Sequence:CCGGCTTTGGAGAATGCTATTGAATCTCGAGATTCAATAGCATTCTCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-249s1c1
Sequence:CCGGAGAATGAAACTGGCAAGGATACTCGAGTATCCTTGCCAGTTTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-630s1c1
Sequence:CCGGCCGCCATGGATGCACTTAATACTCGAGTATTAAGTGCATCCATGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-362s1c1
Sequence:CCGGGCAGCAATCATCAGTAGAGTACTCGAGTACTCTACTGATGATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028292
VALIDATED
PPME1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase methylesterase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-362s21c1
Sequence:CCGGGCAGCAATCATCAGTAGAGTACTCGAGTACTCTACTGATGATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-1034s21c1
Sequence:CCGGGCAGGTGTTGACAGATTGGATCTCGAGATCCAATCTGTCAACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-630s21c1
Sequence:CCGGCCGCCATGGATGCACTTAATACTCGAGTATTAAGTGCATCCATGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-693s21c1
Sequence:CCGGCTTTGGAGAATGCTATTGAATCTCGAGATTCAATAGCATTCTCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-1034s1c1
Sequence:CCGGGCAGGTGTTGACAGATTGGATCTCGAGATCCAATCTGTCAACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-693s1c1
Sequence:CCGGCTTTGGAGAATGCTATTGAATCTCGAGATTCAATAGCATTCTCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-249s1c1
Sequence:CCGGAGAATGAAACTGGCAAGGATACTCGAGTATCCTTGCCAGTTTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-630s1c1
Sequence:CCGGCCGCCATGGATGCACTTAATACTCGAGTATTAAGTGCATCCATGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-362s1c1
Sequence:CCGGGCAGCAATCATCAGTAGAGTACTCGAGTACTCTACTGATGATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028292
VALIDATED
PPME1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase methylesterase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-362s21c1
Sequence:CCGGGCAGCAATCATCAGTAGAGTACTCGAGTACTCTACTGATGATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-1034s21c1
Sequence:CCGGGCAGGTGTTGACAGATTGGATCTCGAGATCCAATCTGTCAACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-630s21c1
Sequence:CCGGCCGCCATGGATGCACTTAATACTCGAGTATTAAGTGCATCCATGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028292.2-693s21c1
Sequence:CCGGCTTTGGAGAATGCTATTGAATCTCGAGATTCAATAGCATTCTCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-1034s1c1
Sequence:CCGGGCAGGTGTTGACAGATTGGATCTCGAGATCCAATCTGTCAACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-693s1c1
Sequence:CCGGCTTTGGAGAATGCTATTGAATCTCGAGATTCAATAGCATTCTCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-249s1c1
Sequence:CCGGAGAATGAAACTGGCAAGGATACTCGAGTATCCTTGCCAGTTTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-630s1c1
Sequence:CCGGCCGCCATGGATGCACTTAATACTCGAGTATTAAGTGCATCCATGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028292.1-362s1c1
Sequence:CCGGGCAGCAATCATCAGTAGAGTACTCGAGTACTCTACTGATGATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)