EMAIL THIS PAGE TO A FRIEND

PPOX

protoporphyrinogen oxidase

140 Gene Product Result for
Synonyms: PPO V290M VP
UniProtKB ID: P50336, D3DVG0, Q5VTW8
Gene ID:
Human(5498) Summary: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(19044) protoporphyrinogen oxidase
Rat(289219) protoporphyrinogen oxidase
cow(515770) protoporphyrinogen oxidase
sheep(101103440) protoporphyrinogen oxidase
naked mole-rat(101703782) protoporphyrinogen oxidase
Domestic Rabbit(100340158) protoporphyrinogen oxidase
domestic guinea pig(100735630) protoporphyrinogen oxidase
fruit fly(42939) Protoporphyrinogen oxidase
Zebrafish(664750) protoporphyrinogen oxidase
Thale Cress(835061) pyridoxine/pyridoxamine 5'-phosphate oxidase 1
dog(478980) protoporphyrinogen oxidase
Horse(100066168) protoporphyrinogen oxidase
domestic cat(101090326) protoporphyrinogen oxidase
Thale Cress(827991) protoporphyrinogen oxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000309 Rosetta Predictions human pricing
NM_001122764 Rosetta Predictions human pricing
NM_001105968 Rosetta Predictions rat pricing
NM_008911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302303 predicted 923
2 SASI_Hs01_00060426 predicted 1405
3 SASI_Hs01_00060427 predicted 1355
4 SASI_Hs01_00060428 predicted 1155
5 SASI_Hs01_00060429 predicted 1083
6 SASI_Hs01_00060430 predicted 1252
7 SASI_Hs02_00302304 predicted 1450
8 SASI_Hs01_00060431 predicted 1417
9 SASI_Hs01_00060432 predicted 911
10 SASI_Hs02_00302305 predicted 1256
11 SASI_Hs01_00060424 predicted 363
12 SASI_Hs01_00060425 predicted 361
13 SASI_Hs01_00060433 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327305 predicted 985
2 SASI_Hs02_00327306 predicted 1459
3 SASI_Hs02_00327307 predicted 1414
4 SASI_Hs02_00327308 predicted 1222
5 SASI_Hs02_00327309 predicted 1143
6 SASI_Hs02_00327310 predicted 1315
7 SASI_Hs02_00327311 predicted 1515
8 SASI_Hs02_00327312 predicted 1476
9 SASI_Hs02_00327313 predicted 970
10 SASI_Hs02_00327314 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214322 predicted 1167
2 SASI_Rn02_00214323 predicted 945
3 SASI_Rn02_00214324 predicted 1542
4 SASI_Rn02_00214325 predicted 1218
5 SASI_Rn02_00214326 predicted 845
6 SASI_Rn02_00214327 predicted 882
7 SASI_Rn02_00214328 predicted 1031
8 SASI_Rn02_00214329 predicted 1246
9 SASI_Rn02_00214330 predicted 1137
10 SASI_Rn02_00214331 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314934 predicted 1220
2 SASI_Mm01_00199877 predicted 393
3 SASI_Mm01_00199879 predicted 351
4 SASI_Mm02_00314935 predicted 737
5 SASI_Mm02_00314936 predicted 804
6 SASI_Mm02_00314937 predicted 1428
7 SASI_Mm01_00199882 predicted 1040
8 SASI_Mm02_00314938 predicted 1560
9 SASI_Mm02_00314939 predicted 1577
10 SASI_Mm02_00314940 predicted 812
11 SASI_Mm01_00199875 predicted 768
12 SASI_Mm01_00199876 predicted 832
13 SASI_Mm01_00199878 predicted 873
14 SASI_Mm01_00199880 predicted 1327
15 SASI_Mm01_00199881 predicted 1240
16 SASI_Mm01_00199883 predicted 1231
17 SASI_Mm01_00199884 predicted 1455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000309
VALIDATED
PPOX MISSION shRNA Bacterial Glycerol Stock
protoporphyrinogen oxidase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-372s21c1
Sequence:GTACCGGGCCCTAATGGTGCTATCTTTGCTCGAGCAAAGATAGCACCATTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1516s21c1
Sequence:CCGGACTAGAGTCAGCTAGGCAATTCTCGAGAATTGCCTAGCTGACTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1267s21c1
Sequence:CCGGCGTGTATGACTCAGTTGCTTTCTCGAGAAAGCAACTGAGTCATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1027s21c1
Sequence:CCGGGCGCTGGAAGGTATCTCTAAGCTCGAGCTTAGAGATACCTTCCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-802s21c1
Sequence:CCGGGCAAACCCATCGTTCCATATTCTCGAGAATATGGAACGATGGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000309.2-1054s1c1
Sequence:CCGGGACCACGTTATTAGTGCCATTCTCGAGAATGGCACTAATAACGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-1254s1c1
Sequence:CCGGCGTGTATGACTCAGTTGCTTTCTCGAGAAAGCAACTGAGTCATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-1452s1c1
Sequence:CCGGCCATCTACACAAGAACTGCATCTCGAGATGCAGTTCTTGTGTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000309.3-1465s21c1
Sequence:CCGGCCATCTACACAAGAACTGCATCTCGAGATGCAGTTCTTGTGTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-789s1c1
Sequence:CCGGGCAAACCCATCGTTCCATATTCTCGAGAATATGGAACGATGGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-357s1c1
Sequence:CCGGAGGCCCTAATGGTGCTATCTTCTCGAGAAGATAGCACCATTAGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000309
VALIDATED
PPOX MISSION shRNA shRNA Plasmid DNA
protoporphyrinogen oxidase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-372s21c1
Sequence:GTACCGGGCCCTAATGGTGCTATCTTTGCTCGAGCAAAGATAGCACCATTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1516s21c1
Sequence:CCGGACTAGAGTCAGCTAGGCAATTCTCGAGAATTGCCTAGCTGACTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1267s21c1
Sequence:CCGGCGTGTATGACTCAGTTGCTTTCTCGAGAAAGCAACTGAGTCATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1027s21c1
Sequence:CCGGGCGCTGGAAGGTATCTCTAAGCTCGAGCTTAGAGATACCTTCCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-802s21c1
Sequence:CCGGGCAAACCCATCGTTCCATATTCTCGAGAATATGGAACGATGGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000309.2-1054s1c1
Sequence:CCGGGACCACGTTATTAGTGCCATTCTCGAGAATGGCACTAATAACGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-1254s1c1
Sequence:CCGGCGTGTATGACTCAGTTGCTTTCTCGAGAAAGCAACTGAGTCATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-1452s1c1
Sequence:CCGGCCATCTACACAAGAACTGCATCTCGAGATGCAGTTCTTGTGTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000309.3-1465s21c1
Sequence:CCGGCCATCTACACAAGAACTGCATCTCGAGATGCAGTTCTTGTGTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-789s1c1
Sequence:CCGGGCAAACCCATCGTTCCATATTCTCGAGAATATGGAACGATGGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-357s1c1
Sequence:CCGGAGGCCCTAATGGTGCTATCTTCTCGAGAAGATAGCACCATTAGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000309
VALIDATED
PPOX MISSION shRNA Lentiviral Transduction Particles
protoporphyrinogen oxidase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-372s21c1
Sequence:GTACCGGGCCCTAATGGTGCTATCTTTGCTCGAGCAAAGATAGCACCATTAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1516s21c1
Sequence:CCGGACTAGAGTCAGCTAGGCAATTCTCGAGAATTGCCTAGCTGACTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1267s21c1
Sequence:CCGGCGTGTATGACTCAGTTGCTTTCTCGAGAAAGCAACTGAGTCATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-1027s21c1
Sequence:CCGGGCGCTGGAAGGTATCTCTAAGCTCGAGCTTAGAGATACCTTCCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000309.3-802s21c1
Sequence:CCGGGCAAACCCATCGTTCCATATTCTCGAGAATATGGAACGATGGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000309.2-1054s1c1
Sequence:CCGGGACCACGTTATTAGTGCCATTCTCGAGAATGGCACTAATAACGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-1254s1c1
Sequence:CCGGCGTGTATGACTCAGTTGCTTTCTCGAGAAAGCAACTGAGTCATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-1452s1c1
Sequence:CCGGCCATCTACACAAGAACTGCATCTCGAGATGCAGTTCTTGTGTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000309.3-1465s21c1
Sequence:CCGGCCATCTACACAAGAACTGCATCTCGAGATGCAGTTCTTGTGTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-789s1c1
Sequence:CCGGGCAAACCCATCGTTCCATATTCTCGAGAATATGGAACGATGGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000309.2-357s1c1
Sequence:CCGGAGGCCCTAATGGTGCTATCTTCTCGAGAAGATAGCACCATTAGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008911
VALIDATED
PPOX MISSION shRNA Bacterial Glycerol Stock
protoporphyrinogen oxidase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-950s21c1
Sequence:CCGGCAGCCGGATTCCTCACTAATTCTCGAGAATTAGTGAGGAATCCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-815s21c1
Sequence:CCGGAGTCTTTGCCGAGGAGTATTTCTCGAGAAATACTCCTCGGCAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-359s21c1
Sequence:CCGGAGTGGATTGGCCGCAAGTTATCTCGAGATAACTTGCGGCCAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-895s21c1
Sequence:CCGGACAAACCCACCGGTCCATATTCTCGAGAATATGGACCGGTGGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-1043s21c1
Sequence:CCGGCACAATCACCTAGCAAGTAAACTCGAGTTTACTTGCTAGGTGATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008911.1-925s1c1
Sequence:CCGGCAGCCGGATTCCTCACTAATTCTCGAGAATTAGTGAGGAATCCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-1527s1c1
Sequence:CCGGCCTGGTCCATCTACACAAGAACTCGAGTTCTTGTGTAGATGGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008911.1-372s1c1
Sequence:CCGGCAGTCCTCCTAAGGTGATCTTCTCGAGAAGATCACCTTAGGAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-924s1c1
Sequence:CCGGCCAGCCGGATTCCTCACTAATCTCGAGATTAGTGAGGAATCCGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-785s21c1
Sequence:CCGGGGACCTGAGGTGGCATCTTTACTCGAGTAAAGATGCCACCTCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-1488s1c1
Sequence:CCGGCGCCACACAGTTAGGACTAAACTCGAGTTTAGTCCTAACTGTGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008911
VALIDATED
PPOX MISSION shRNA shRNA Plasmid DNA
protoporphyrinogen oxidase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-950s21c1
Sequence:CCGGCAGCCGGATTCCTCACTAATTCTCGAGAATTAGTGAGGAATCCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-815s21c1
Sequence:CCGGAGTCTTTGCCGAGGAGTATTTCTCGAGAAATACTCCTCGGCAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-359s21c1
Sequence:CCGGAGTGGATTGGCCGCAAGTTATCTCGAGATAACTTGCGGCCAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-895s21c1
Sequence:CCGGACAAACCCACCGGTCCATATTCTCGAGAATATGGACCGGTGGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-1043s21c1
Sequence:CCGGCACAATCACCTAGCAAGTAAACTCGAGTTTACTTGCTAGGTGATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008911.1-925s1c1
Sequence:CCGGCAGCCGGATTCCTCACTAATTCTCGAGAATTAGTGAGGAATCCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-1527s1c1
Sequence:CCGGCCTGGTCCATCTACACAAGAACTCGAGTTCTTGTGTAGATGGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008911.1-372s1c1
Sequence:CCGGCAGTCCTCCTAAGGTGATCTTCTCGAGAAGATCACCTTAGGAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-924s1c1
Sequence:CCGGCCAGCCGGATTCCTCACTAATCTCGAGATTAGTGAGGAATCCGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-785s21c1
Sequence:CCGGGGACCTGAGGTGGCATCTTTACTCGAGTAAAGATGCCACCTCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-1488s1c1
Sequence:CCGGCGCCACACAGTTAGGACTAAACTCGAGTTTAGTCCTAACTGTGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008911
VALIDATED
PPOX MISSION shRNA Lentiviral Transduction Particles
protoporphyrinogen oxidase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-950s21c1
Sequence:CCGGCAGCCGGATTCCTCACTAATTCTCGAGAATTAGTGAGGAATCCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-815s21c1
Sequence:CCGGAGTCTTTGCCGAGGAGTATTTCTCGAGAAATACTCCTCGGCAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-359s21c1
Sequence:CCGGAGTGGATTGGCCGCAAGTTATCTCGAGATAACTTGCGGCCAATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-895s21c1
Sequence:CCGGACAAACCCACCGGTCCATATTCTCGAGAATATGGACCGGTGGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008911.2-1043s21c1
Sequence:CCGGCACAATCACCTAGCAAGTAAACTCGAGTTTACTTGCTAGGTGATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008911.1-925s1c1
Sequence:CCGGCAGCCGGATTCCTCACTAATTCTCGAGAATTAGTGAGGAATCCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-1527s1c1
Sequence:CCGGCCTGGTCCATCTACACAAGAACTCGAGTTCTTGTGTAGATGGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008911.1-372s1c1
Sequence:CCGGCAGTCCTCCTAAGGTGATCTTCTCGAGAAGATCACCTTAGGAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-924s1c1
Sequence:CCGGCCAGCCGGATTCCTCACTAATCTCGAGATTAGTGAGGAATCCGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008911.2-785s21c1
Sequence:CCGGGGACCTGAGGTGGCATCTTTACTCGAGTAAAGATGCCACCTCAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008911.1-1488s1c1
Sequence:CCGGCGCCACACAGTTAGGACTAAACTCGAGTTTAGTCCTAACTGTGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)