EMAIL THIS PAGE TO A FRIEND

PPP1CA

protein phosphatase 1, catalytic subunit, alpha isozyme

98 Gene Product Result for
Synonyms: PP-1A PP1A PP1alpha PPP1A
Gene ID:
Human(5499) Summary: The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies in both human and mice suggest that PP1 is an important regulator of cardiac function. Mouse studies also suggest that PP1 functions as a suppressor of learning and memory. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(19045) protein phosphatase 1, catalytic subunit, alpha isoform
Rat(24668) protein phosphatase 1, catalytic subunit, alpha isozyme
dog(403609) protein phosphatase 1, catalytic subunit, alpha isozyme
Horse(100059233) protein phosphatase 1, catalytic subunit, alpha isozyme
domestic cat(101080405) protein phosphatase 1, catalytic subunit, alpha isozyme
domestic guinea pig(100721697) protein phosphatase 1, catalytic subunit, alpha isozyme
Domestic Rabbit(100009298) protein phosphatase 1, catalytic subunit, alpha isozyme
naked mole-rat(101705408) protein phosphatase 1, catalytic subunit, alpha isozyme
cow(516175) protein phosphatase 1, catalytic subunit, alpha isozyme
sheep(101119264) protein phosphatase 1, catalytic subunit, alpha isozyme
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008709 siRNAs that have been validated in the lab human pricing
NM_002708 siRNAs that have been validated in the lab human pricing
NM_206873 siRNAs that have been validated in the lab human pricing
NM_031527 Rosetta Predictions rat pricing
NM_031868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008709 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016506 validated 958
2 SASI_Hs01_00016507 predicted 546
3 SASI_Hs01_00016508 predicted 578
4 SASI_Hs01_00016509 predicted 911
5 SASI_Hs01_00016510 predicted 568
6 SASI_Hs01_00016511 predicted 542
7 SASI_Hs01_00016513 predicted 577
8 SASI_Hs01_00016514 predicted 798
9 SASI_Hs02_00305537 predicted 767
10 SASI_Hs01_00016515 predicted 849
11 SASI_Hs01_00016512 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002708 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028541 validated 932
2 SASI_Hs01_00028542 predicted 515
3 SASI_Hs01_00028543 predicted 538
4 SASI_Hs01_00028544 predicted 881
5 SASI_Hs01_00028545 predicted 534
6 SASI_Hs01_00028546 predicted 513
7 SASI_Hs01_00028548 predicted 542
8 SASI_Hs01_00028549 predicted 763
9 SASI_Hs02_00334291 predicted 737
10 SASI_Hs01_00028550 predicted 812
11 SASI_Hs01_00028547 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206873 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061180 validated 793
2 SASI_Hs01_00061181 predicted 386
3 SASI_Hs01_00061182 predicted 407
4 SASI_Hs01_00061183 predicted 742
5 SASI_Hs01_00061184 predicted 400
6 SASI_Hs01_00061185 predicted 383
7 SASI_Hs01_00061187 predicted 410
8 SASI_Hs01_00061188 predicted 632
9 SASI_Hs02_00373573 predicted 606
10 SASI_Hs01_00061189 predicted 688
11 SASI_Hs01_00061186 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035281 predicted 460
2 SASI_Rn01_00035282 predicted 802
3 SASI_Rn01_00035283 predicted 372
4 SASI_Rn02_00264677 predicted 412
5 SASI_Rn01_00035284 predicted 486
6 SASI_Rn01_00035285 predicted 467
7 SASI_Rn01_00035286 predicted 456
8 SASI_Rn01_00035287 predicted 763
9 SASI_Rn01_00035288 predicted 1047
10 SASI_Rn01_00035289 predicted 482
11 SASI_Rn01_00035290 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054696 predicted 774
2 SASI_Mm01_00054697 predicted 431
3 SASI_Mm01_00054698 predicted 435
4 SASI_Mm01_00054700 predicted 736
5 SASI_Mm01_00054701 predicted 437
6 SASI_Mm01_00054702 predicted 803
7 SASI_Mm01_00054703 predicted 382
8 SASI_Mm01_00054704 predicted 737
9 SASI_Mm01_00054705 predicted 1130
10 SASI_Mm02_00337182 predicted 462
11 SASI_Mm01_00054699 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002708
VALIDATED
PPP1CA MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, catalytic subunit, alpha isozyme
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-1082s1c1
Sequence:CCGGAGATGATGGATTGATTGTACACTCGAGTGTACAATCAATCCATCATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-1030s1c1
Sequence:CCGGCCGCAATTCCGCCAAAGCCAACTCGAGTTGGCTTTGGCGGAATTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-982s21c1
Sequence:GTACCGGGAGACCCTCATGTGCTCTTTCCTCGAGGAAAGAGCACATGAGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-478s1c1
Sequence:CCGGTGAGTGCAAGAGACGCTACAACTCGAGTTGTAGCGTCTCTTGCACTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-537s21c1
Sequence:CCGGTGAGTGCAAGAGACGCTACAACTCGAGTTGTAGCGTCTCTTGCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-270s1c1
Sequence:CCGGACTACGACCTTCTGCGACTATCTCGAGATAGTCGCAGAAGGTCGTAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-382s1c1
Sequence:CCGGGCTGCTGGCCTATAAGATCAACTCGAGTTGATCTTATAGGCCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-329s21c1
Sequence:CCGGACTACGACCTTCTGCGACTATCTCGAGATAGTCGCAGAAGGTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-1141s21c1
Sequence:CCGGAGATGATGGATTGATTGTACACTCGAGTGTACAATCAATCCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-441s21c1
Sequence:CCGGGCTGCTGGCCTATAAGATCAACTCGAGTTGATCTTATAGGCCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002708
VALIDATED
PPP1CA MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, catalytic subunit, alpha isozyme
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-1082s1c1
Sequence:CCGGAGATGATGGATTGATTGTACACTCGAGTGTACAATCAATCCATCATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-1030s1c1
Sequence:CCGGCCGCAATTCCGCCAAAGCCAACTCGAGTTGGCTTTGGCGGAATTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-982s21c1
Sequence:GTACCGGGAGACCCTCATGTGCTCTTTCCTCGAGGAAAGAGCACATGAGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-478s1c1
Sequence:CCGGTGAGTGCAAGAGACGCTACAACTCGAGTTGTAGCGTCTCTTGCACTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-537s21c1
Sequence:CCGGTGAGTGCAAGAGACGCTACAACTCGAGTTGTAGCGTCTCTTGCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-270s1c1
Sequence:CCGGACTACGACCTTCTGCGACTATCTCGAGATAGTCGCAGAAGGTCGTAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-382s1c1
Sequence:CCGGGCTGCTGGCCTATAAGATCAACTCGAGTTGATCTTATAGGCCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-329s21c1
Sequence:CCGGACTACGACCTTCTGCGACTATCTCGAGATAGTCGCAGAAGGTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-1141s21c1
Sequence:CCGGAGATGATGGATTGATTGTACACTCGAGTGTACAATCAATCCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-441s21c1
Sequence:CCGGGCTGCTGGCCTATAAGATCAACTCGAGTTGATCTTATAGGCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002708
VALIDATED
PPP1CA MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, catalytic subunit, alpha isozyme
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-1082s1c1
Sequence:CCGGAGATGATGGATTGATTGTACACTCGAGTGTACAATCAATCCATCATCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-1030s1c1
Sequence:CCGGCCGCAATTCCGCCAAAGCCAACTCGAGTTGGCTTTGGCGGAATTGCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-982s21c1
Sequence:GTACCGGGAGACCCTCATGTGCTCTTTCCTCGAGGAAAGAGCACATGAGGGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-478s1c1
Sequence:CCGGTGAGTGCAAGAGACGCTACAACTCGAGTTGTAGCGTCTCTTGCACTCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-537s21c1
Sequence:CCGGTGAGTGCAAGAGACGCTACAACTCGAGTTGTAGCGTCTCTTGCACTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-270s1c1
Sequence:CCGGACTACGACCTTCTGCGACTATCTCGAGATAGTCGCAGAAGGTCGTAGTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002708.x-382s1c1
Sequence:CCGGGCTGCTGGCCTATAAGATCAACTCGAGTTGATCTTATAGGCCAGCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-329s21c1
Sequence:CCGGACTACGACCTTCTGCGACTATCTCGAGATAGTCGCAGAAGGTCGTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-1141s21c1
Sequence:CCGGAGATGATGGATTGATTGTACACTCGAGTGTACAATCAATCCATCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002708.3-441s21c1
Sequence:CCGGGCTGCTGGCCTATAAGATCAACTCGAGTTGATCTTATAGGCCAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031868
VALIDATED
PPP1CA MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, catalytic subunit, alpha isozyme
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031868.2-1060s21c1
Sequence:CCGGCCAGATCGTTTGTACAGAAATCTCGAGATTTCTGTACAAACGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-387s1c1
Sequence:CCGGCCGGAGAATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATTCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-1061s1c1
Sequence:CCGGCCAGATCGTTTGTACAGAAATCTCGAGATTTCTGTACAAACGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031868.1-938s1c1
Sequence:CCGGCGCTGATAAGAATAAGGGCAACTCGAGTTGCCCTTATTCTTATCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-266s1c1
Sequence:CCGGGCTGTTTGAGTATGGTGGCTTCTCGAGAAGCCACCATACTCAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-705s1c1
Sequence:CCGGCGTGGTGTCTCCTTTACCTTTCTCGAGAAAGGTAAAGGAGACACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-386s21c1
Sequence:CCGGCCGGAGAATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-704s21c1
Sequence:CCGGCGTGGTGTCTCCTTTACCTTTCTCGAGAAAGGTAAAGGAGACACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-265s21c1
Sequence:CCGGGCTGTTTGAGTATGGTGGCTTCTCGAGAAGCCACCATACTCAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031868
VALIDATED
PPP1CA MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, catalytic subunit, alpha isozyme
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031868.2-1060s21c1
Sequence:CCGGCCAGATCGTTTGTACAGAAATCTCGAGATTTCTGTACAAACGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-387s1c1
Sequence:CCGGCCGGAGAATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATTCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-1061s1c1
Sequence:CCGGCCAGATCGTTTGTACAGAAATCTCGAGATTTCTGTACAAACGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031868.1-938s1c1
Sequence:CCGGCGCTGATAAGAATAAGGGCAACTCGAGTTGCCCTTATTCTTATCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-266s1c1
Sequence:CCGGGCTGTTTGAGTATGGTGGCTTCTCGAGAAGCCACCATACTCAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-705s1c1
Sequence:CCGGCGTGGTGTCTCCTTTACCTTTCTCGAGAAAGGTAAAGGAGACACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-386s21c1
Sequence:CCGGCCGGAGAATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-704s21c1
Sequence:CCGGCGTGGTGTCTCCTTTACCTTTCTCGAGAAAGGTAAAGGAGACACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-265s21c1
Sequence:CCGGGCTGTTTGAGTATGGTGGCTTCTCGAGAAGCCACCATACTCAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031868
VALIDATED
PPP1CA MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, catalytic subunit, alpha isozyme
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031868.2-1060s21c1
Sequence:CCGGCCAGATCGTTTGTACAGAAATCTCGAGATTTCTGTACAAACGATCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-387s1c1
Sequence:CCGGCCGGAGAATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATTCTCCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-1061s1c1
Sequence:CCGGCCAGATCGTTTGTACAGAAATCTCGAGATTTCTGTACAAACGATCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031868.1-938s1c1
Sequence:CCGGCGCTGATAAGAATAAGGGCAACTCGAGTTGCCCTTATTCTTATCAGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-266s1c1
Sequence:CCGGGCTGTTTGAGTATGGTGGCTTCTCGAGAAGCCACCATACTCAAACAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031868.1-705s1c1
Sequence:CCGGCGTGGTGTCTCCTTTACCTTTCTCGAGAAAGGTAAAGGAGACACCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000280198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-386s21c1
Sequence:CCGGCCGGAGAATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATTCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000297349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-704s21c1
Sequence:CCGGCGTGGTGTCTCCTTTACCTTTCTCGAGAAAGGTAAAGGAGACACCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000297780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031868.2-265s21c1
Sequence:CCGGGCTGTTTGAGTATGGTGGCTTCTCGAGAAGCCACCATACTCAAACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???