EMAIL THIS PAGE TO A FRIEND

PPP1CB

protein phosphatase 1, catalytic subunit, beta isozyme

225 Gene Product Result for
Synonyms: PP-1B PP1B PP1beta PPP1CD
UniProtKB ID: P62140, B2R5V4, D6W565, P37140, Q5U087, Q6FG45
Gene ID:
Human(5500) Summary: The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Mouse studies suggest that PP1 functions as a suppressor of learning and memory. Two alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(19046) protein phosphatase 1, catalytic subunit, beta isoform
Rat(25594) protein phosphatase 1, catalytic subunit, beta isozyme
Zebrafish(100003223) protein phosphatase 1, catalytic subunit, beta isoform
chicken(396019) protein phosphatase 1, catalytic subunit, beta isozyme
domestic cat(101092932) protein phosphatase 1, catalytic subunit, beta isozyme
dog(403558) protein phosphatase 1, catalytic subunit, beta isozyme
cow(538829) protein phosphatase 1, catalytic subunit, beta isozyme
sheep(101123197) protein phosphatase 1, catalytic subunit, beta isozyme
naked mole-rat(101698044) protein phosphatase 1, catalytic subunit, beta isozyme
domestic guinea pig(100730372) protein phosphatase 1, catalytic subunit, beta isozyme
Gene Class: Cell_Division
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008781 MISSION® esiRNA esiRNA targeting mouse Ppp1cb (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002709 siRNAs that have been validated in the lab human pricing
NM_206876 siRNAs that have been validated in the lab human pricing
NM_206877 siRNAs that have been validated in the lab human pricing
NM_013065 Rosetta Predictions rat pricing
NM_172707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002709 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166315 validated 1442
2 SASI_Hs01_00166316 predicted 648
3 SASI_Hs01_00166317 predicted 972
4 SASI_Hs02_00334292 predicted 667
5 SASI_Hs01_00166318 predicted 1059
6 SASI_Hs01_00166319 predicted 777
7 SASI_Hs01_00166320 predicted 954
8 SASI_Hs02_00334293 predicted 490
9 SASI_Hs01_00166322 predicted 1210
10 SASI_Hs01_00166323 predicted 1140
11 SASI_Hs01_00166314 predicted 1454
12 SASI_Hs01_00166321 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206876 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234032 validated 1236
2 SASI_Hs01_00234033 predicted 450
3 SASI_Hs01_00234034 predicted 772
4 SASI_Hs02_00373574 predicted 465
5 SASI_Hs01_00234035 predicted 851
6 SASI_Hs01_00234036 predicted 572
7 SASI_Hs01_00234037 predicted 741
8 SASI_Hs02_00373575 predicted 282
9 SASI_Hs01_00234039 predicted 1009
10 SASI_Hs01_00234040 predicted 938
11 SASI_Hs01_00234031 predicted 1242
12 SASI_Hs01_00234038 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206877 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176735 validated 738
2 SASI_Hs01_00176730 predicted 750
3 SASI_Hs01_00176731 predicted 888
4 SASI_Hs01_00176732 predicted 811
5 SASI_Hs01_00176733 predicted 828
6 SASI_Hs01_00176734 predicted 849
7 SASI_Hs01_00176736 predicted 838
8 SASI_Hs01_00176737 predicted 495
9 SASI_Hs01_00176738 predicted 443
10 SASI_Hs01_00176739 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260805 predicted 677
2 SASI_Rn02_00260806 predicted 647
3 SASI_Rn01_00051922 predicted 1009
4 SASI_Rn02_00260807 predicted 652
5 SASI_Rn02_00260808 predicted 1220
6 SASI_Rn01_00051925 predicted 372
7 SASI_Rn02_00260809 predicted 1035
8 SASI_Rn01_00051926 predicted 1328
9 SASI_Rn02_00260810 predicted 569
10 SASI_Rn02_00260811 predicted 953
11 SASI_Rn01_00051923 predicted 1066
12 SASI_Rn01_00051924 predicted 1281
13 SASI_Rn01_00051927 predicted 1349
14 SASI_Rn01_00051928 predicted 1347
15 SASI_Rn01_00051929 predicted 1287
16 SASI_Rn01_00051930 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063633 predicted 1090
2 SASI_Mm01_00063634 predicted 1343
3 SASI_Mm02_00344476 predicted 1393
4 SASI_Mm01_00063635 predicted 1454
5 SASI_Mm01_00063636 predicted 970
6 SASI_Mm01_00063637 predicted 695
7 SASI_Mm01_00063638 predicted 489
8 SASI_Mm01_00063639 predicted 1077
9 SASI_Mm01_00063640 predicted 1163
10 SASI_Mm01_00063641 predicted 1465
11 SASI_Mm01_00063642 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002709
VALIDATED
PPP1CB MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, catalytic subunit, beta isozyme
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-481s21c1
Sequence:GTACCGGTCAAGTCTCGGGAGATCTTTCCTCGAGGAAAGATCTCCCGAGACTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1065s21c1
Sequence:CCGGTTTCTGAATCGTCATGATTTACTCGAGTAAATCATGACGATTCAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1143s21c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-774s21c1
Sequence:CCGGGATGAATGCAAACGAAGATTTCTCGAGAAATCTTCGTTTGCATTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-727s21c1
Sequence:CCGGGAGGAAACCATGAGTGTGCTACTCGAGTAGCACACTCATGGTTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002709.x-814s1c1
Sequence:CCGGCGGAGAATTATGAGACCTACTCTCGAGAGTAGGTCTCATAATTCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1464s21c1
Sequence:CCGGTAACTTAAGGAGACGGGTAAACTCGAGTTTACCCGTCTCCTTAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-974s21c1
Sequence:GTACCGGGCTATGGTCTGATCCAGATAACTCGAGTTATCTGGATCAGACCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-675s21c1
Sequence:GTACCGGTGTTTGCTATTGGCTTATAAACTCGAGTTTATAAGCCAATAGCAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002709.x-1079s1c1
Sequence:CCGGAGTTTGATAATGCTGGTGGAACTCGAGTTCCACCAGCATTATCAAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002709.x-1216s1c1
Sequence:CCGGACAGCTAATCCGCCGAAGAAACTCGAGTTTCTTCGGCGGATTAGCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002709.x-2211s1c1
Sequence:CCGGCCACAGTACATGAGAATCCTTCTCGAGAAGGATTCTCATGTACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002709.x-620s1c1
Sequence:CCGGGAGGAAACCATGAGTGTGCTACTCGAGTAGCACACTCATGGTTTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002709
VALIDATED
PPP1CB MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, catalytic subunit, beta isozyme
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-481s21c1
Sequence:GTACCGGTCAAGTCTCGGGAGATCTTTCCTCGAGGAAAGATCTCCCGAGACTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1065s21c1
Sequence:CCGGTTTCTGAATCGTCATGATTTACTCGAGTAAATCATGACGATTCAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1143s21c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-774s21c1
Sequence:CCGGGATGAATGCAAACGAAGATTTCTCGAGAAATCTTCGTTTGCATTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-727s21c1
Sequence:CCGGGAGGAAACCATGAGTGTGCTACTCGAGTAGCACACTCATGGTTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002709.x-814s1c1
Sequence:CCGGCGGAGAATTATGAGACCTACTCTCGAGAGTAGGTCTCATAATTCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1464s21c1
Sequence:CCGGTAACTTAAGGAGACGGGTAAACTCGAGTTTACCCGTCTCCTTAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-974s21c1
Sequence:GTACCGGGCTATGGTCTGATCCAGATAACTCGAGTTATCTGGATCAGACCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-675s21c1
Sequence:GTACCGGTGTTTGCTATTGGCTTATAAACTCGAGTTTATAAGCCAATAGCAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002709.x-1079s1c1
Sequence:CCGGAGTTTGATAATGCTGGTGGAACTCGAGTTCCACCAGCATTATCAAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002709.x-1216s1c1
Sequence:CCGGACAGCTAATCCGCCGAAGAAACTCGAGTTTCTTCGGCGGATTAGCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002709.x-2211s1c1
Sequence:CCGGCCACAGTACATGAGAATCCTTCTCGAGAAGGATTCTCATGTACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002709.x-620s1c1
Sequence:CCGGGAGGAAACCATGAGTGTGCTACTCGAGTAGCACACTCATGGTTTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002709
VALIDATED
PPP1CB MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, catalytic subunit, beta isozyme
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-481s21c1
Sequence:GTACCGGTCAAGTCTCGGGAGATCTTTCCTCGAGGAAAGATCTCCCGAGACTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1065s21c1
Sequence:CCGGTTTCTGAATCGTCATGATTTACTCGAGTAAATCATGACGATTCAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1143s21c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-774s21c1
Sequence:CCGGGATGAATGCAAACGAAGATTTCTCGAGAAATCTTCGTTTGCATTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-727s21c1
Sequence:CCGGGAGGAAACCATGAGTGTGCTACTCGAGTAGCACACTCATGGTTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002709.x-814s1c1
Sequence:CCGGCGGAGAATTATGAGACCTACTCTCGAGAGTAGGTCTCATAATTCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002709.2-1464s21c1
Sequence:CCGGTAACTTAAGGAGACGGGTAAACTCGAGTTTACCCGTCTCCTTAAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-974s21c1
Sequence:GTACCGGGCTATGGTCTGATCCAGATAACTCGAGTTATCTGGATCAGACCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002709.2-675s21c1
Sequence:GTACCGGTGTTTGCTATTGGCTTATAAACTCGAGTTTATAAGCCAATAGCAAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002709.x-1079s1c1
Sequence:CCGGAGTTTGATAATGCTGGTGGAACTCGAGTTCCACCAGCATTATCAAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002709.x-1216s1c1
Sequence:CCGGACAGCTAATCCGCCGAAGAAACTCGAGTTTCTTCGGCGGATTAGCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002709.x-2211s1c1
Sequence:CCGGCCACAGTACATGAGAATCCTTCTCGAGAAGGATTCTCATGTACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002709.x-620s1c1
Sequence:CCGGGAGGAAACCATGAGTGTGCTACTCGAGTAGCACACTCATGGTTTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172707
PPP1CB MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-497s21c1
Sequence:CCGGGTGTATCAAGTCTCGTGAAATCTCGAGATTTCACGAGACTTGATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-965s21c1
Sequence:CCGGCGTACCTGATACAGGTTTGCTCTCGAGAGCAAACCTGTATCAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-1164s21c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172707.3-2867s21c3
Sequence:CCGGGCGTCCTTGAAAGTGTTAAATCTCGAGATTTAACACTTTCAAGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172707.1-2580s1c1
Sequence:CCGGGCGTCCTTGAAAGTGTTAAATCTCGAGATTTAACACTTTCAAGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-875s1c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-676s1c1
Sequence:CCGGCGTACCTGATACAGGTTTGCTCTCGAGAGCAAACCTGTATCAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-901s1c1
Sequence:CCGGCCCAAATTACTGTGGCGAGTTCTCGAGAACTCGCCACAGTAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-578s1c1
Sequence:CCGGGCTGCTATTGTTGATGAGAAACTCGAGTTTCTCATCAACAATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-795s21c1
Sequence:CCGGGATGAGTGTAAACGAAGATTTCTCGAGAAATCTTCGTTTACACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172707
PPP1CB MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-497s21c1
Sequence:CCGGGTGTATCAAGTCTCGTGAAATCTCGAGATTTCACGAGACTTGATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-965s21c1
Sequence:CCGGCGTACCTGATACAGGTTTGCTCTCGAGAGCAAACCTGTATCAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-1164s21c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172707.3-2867s21c3
Sequence:CCGGGCGTCCTTGAAAGTGTTAAATCTCGAGATTTAACACTTTCAAGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172707.1-2580s1c1
Sequence:CCGGGCGTCCTTGAAAGTGTTAAATCTCGAGATTTAACACTTTCAAGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-875s1c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-676s1c1
Sequence:CCGGCGTACCTGATACAGGTTTGCTCTCGAGAGCAAACCTGTATCAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-901s1c1
Sequence:CCGGCCCAAATTACTGTGGCGAGTTCTCGAGAACTCGCCACAGTAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-578s1c1
Sequence:CCGGGCTGCTATTGTTGATGAGAAACTCGAGTTTCTCATCAACAATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-795s21c1
Sequence:CCGGGATGAGTGTAAACGAAGATTTCTCGAGAAATCTTCGTTTACACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172707
PPP1CB MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-497s21c1
Sequence:CCGGGTGTATCAAGTCTCGTGAAATCTCGAGATTTCACGAGACTTGATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-965s21c1
Sequence:CCGGCGTACCTGATACAGGTTTGCTCTCGAGAGCAAACCTGTATCAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-1164s21c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172707.3-2867s21c3
Sequence:CCGGGCGTCCTTGAAAGTGTTAAATCTCGAGATTTAACACTTTCAAGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172707.1-2580s1c1
Sequence:CCGGGCGTCCTTGAAAGTGTTAAATCTCGAGATTTAACACTTTCAAGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-875s1c1
Sequence:CCGGCGACAGTTGGTAACCTTATTTCTCGAGAAATAAGGTTACCAACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-676s1c1
Sequence:CCGGCGTACCTGATACAGGTTTGCTCTCGAGAGCAAACCTGTATCAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-901s1c1
Sequence:CCGGCCCAAATTACTGTGGCGAGTTCTCGAGAACTCGCCACAGTAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172707.1-578s1c1
Sequence:CCGGGCTGCTATTGTTGATGAGAAACTCGAGTTTCTCATCAACAATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172707.3-795s21c1
Sequence:CCGGGATGAGTGTAAACGAAGATTTCTCGAGAAATCTTCGTTTACACTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)