EMAIL THIS PAGE TO A FRIEND

PPP1CC

protein phosphatase 1, catalytic subunit, gamma isozyme

137 Gene Product Result for
Synonyms: PP-1G PP1C PPP1G
UniProtKB ID: P36873
Gene ID:
Human(5501) Summary: The protein encoded by this gene belongs to the protein phosphatase family, PP1 subfamily. PP1 is an ubiquitous serine/threonine phosphatase that regulates many cellular processes, including cell division. It is expressed in mammalian cells as three closely related isoforms, alpha, beta/delta and gamma, which have distinct localization patterns. This gene encodes the gamma isozyme. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(19047) protein phosphatase 1, catalytic subunit, gamma isoform
Rat(24669) protein phosphatase 1, catalytic subunit, gamma isozyme
Zebrafish(571753) protein phosphatase 1, catalytic subunit, gamma isoform
domestic cat(101100922) protein phosphatase 1, catalytic subunit, gamma isozyme
dog(403557) protein phosphatase 1, catalytic subunit, gamma isozyme
chicken(416872) protein phosphatase 1, catalytic subunit, gamma isozyme
domestic guinea pig(100728198) protein phosphatase 1, catalytic subunit, gamma isozyme
naked mole-rat(101714468) protein phosphatase 1, catalytic subunit, gamma isozyme
cow(282318) protein phosphatase 1, catalytic subunit, gamma isozyme
sheep(101106284) protein phosphatase 1, catalytic subunit, gamma isozyme
Gene Class: Cell_Division
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002710 siRNAs that have been validated in the lab human pricing
NM_022498 Rosetta Predictions rat pricing
NM_013636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002710 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238355 validated 854
2 SASI_Hs01_00238356 predicted 962
3 SASI_Hs01_00238357 predicted 540
4 SASI_Hs01_00238358 predicted 959
5 SASI_Hs01_00238359 predicted 1182
6 SASI_Hs01_00238360 predicted 529
7 SASI_Hs01_00238361 predicted 865
8 SASI_Hs01_00238362 predicted 952
9 SASI_Hs01_00238363 predicted 443
10 SASI_Hs01_00238364 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077425 predicted 788
2 SASI_Rn02_00263184 predicted 751
3 SASI_Rn01_00077428 predicted 262
4 SASI_Rn01_00077429 predicted 824
5 SASI_Rn01_00077430 predicted 415
6 SASI_Rn01_00077431 predicted 860
7 SASI_Rn01_00077432 predicted 462
8 SASI_Rn02_00263185 predicted 510
9 SASI_Rn01_00077434 predicted 372
10 SASI_Rn02_00263186 predicted 648
11 SASI_Rn01_00077426 predicted 257
12 SASI_Rn01_00077427 predicted 593
13 SASI_Rn01_00077433 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322426 predicted 986
2 SASI_Mm02_00322427 predicted 987
3 SASI_Mm02_00322428 predicted 1238
4 SASI_Mm02_00322429 predicted 1272
5 SASI_Mm02_00322430 predicted 791
6 SASI_Mm02_00322431 predicted 468
7 SASI_Mm02_00322432 predicted 1059
8 SASI_Mm02_00322433 predicted 708
9 SASI_Mm02_00322434 predicted 777
10 SASI_Mm02_00322435 predicted 1392
11 SASI_Mm01_00195481 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002710
VALIDATED
PPP1CC MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, catalytic subunit, gamma isozyme
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-359s21c1
Sequence:GTACCGGGTGCTTAAAGTCTCGTGAAATCTCGAGATTTCACGAGACTTTAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-1054s21c1
Sequence:GTACCGGCCAATTATTGCGGAGAGTTTGCTCGAGCAAACTCTCCGCAATAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002710.2-2156s21c1
Sequence:CCGGGTGACCGATTATGCTTTCTTTCTCGAGAAAGAAAGCATAATCGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-806s21c1
Sequence:CCGGGCGAATTATGCGACCAACTGACTCGAGTCAGTTGGTCGCATAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-754s21c1
Sequence:CCGGTCTGCTGTCATGGAGGTTTATCTCGAGATAAACCTCCATGACAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-1156s21c1
Sequence:CCGGCAAATGCCACGAGACCTGTAACTCGAGTTACAGGTCTCGTGGCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002710.x-1065s1c1
Sequence:CCGGCAAATGCCACGAGACCTGTAACTCGAGTTACAGGTCTCGTGGCATTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002710.x-663s1c1
Sequence:CCGGTCTGCTGTCATGGAGGTTTATCTCGAGATAAACCTCCATGACAGCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002710.x-715s1c1
Sequence:CCGGGCGAATTATGCGACCAACTGACTCGAGTCAGTTGGTCGCATAATTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002710.x-830s1c1
Sequence:CCGGACATTTGGTGCAGAAGTGGTTCTCGAGAACCACTTCTGCACCAAATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002710
VALIDATED
PPP1CC MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, catalytic subunit, gamma isozyme
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-359s21c1
Sequence:GTACCGGGTGCTTAAAGTCTCGTGAAATCTCGAGATTTCACGAGACTTTAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-1054s21c1
Sequence:GTACCGGCCAATTATTGCGGAGAGTTTGCTCGAGCAAACTCTCCGCAATAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002710.2-2156s21c1
Sequence:CCGGGTGACCGATTATGCTTTCTTTCTCGAGAAAGAAAGCATAATCGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-806s21c1
Sequence:CCGGGCGAATTATGCGACCAACTGACTCGAGTCAGTTGGTCGCATAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-754s21c1
Sequence:CCGGTCTGCTGTCATGGAGGTTTATCTCGAGATAAACCTCCATGACAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-1156s21c1
Sequence:CCGGCAAATGCCACGAGACCTGTAACTCGAGTTACAGGTCTCGTGGCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002710.x-1065s1c1
Sequence:CCGGCAAATGCCACGAGACCTGTAACTCGAGTTACAGGTCTCGTGGCATTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002710.x-663s1c1
Sequence:CCGGTCTGCTGTCATGGAGGTTTATCTCGAGATAAACCTCCATGACAGCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002710.x-715s1c1
Sequence:CCGGGCGAATTATGCGACCAACTGACTCGAGTCAGTTGGTCGCATAATTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002710.x-830s1c1
Sequence:CCGGACATTTGGTGCAGAAGTGGTTCTCGAGAACCACTTCTGCACCAAATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002710
VALIDATED
PPP1CC MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, catalytic subunit, gamma isozyme
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-359s21c1
Sequence:GTACCGGGTGCTTAAAGTCTCGTGAAATCTCGAGATTTCACGAGACTTTAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-1054s21c1
Sequence:GTACCGGCCAATTATTGCGGAGAGTTTGCTCGAGCAAACTCTCCGCAATAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002710.2-2156s21c1
Sequence:CCGGGTGACCGATTATGCTTTCTTTCTCGAGAAAGAAAGCATAATCGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-806s21c1
Sequence:CCGGGCGAATTATGCGACCAACTGACTCGAGTCAGTTGGTCGCATAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-754s21c1
Sequence:CCGGTCTGCTGTCATGGAGGTTTATCTCGAGATAAACCTCCATGACAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002710.2-1156s21c1
Sequence:CCGGCAAATGCCACGAGACCTGTAACTCGAGTTACAGGTCTCGTGGCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002710.x-1065s1c1
Sequence:CCGGCAAATGCCACGAGACCTGTAACTCGAGTTACAGGTCTCGTGGCATTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002710.x-663s1c1
Sequence:CCGGTCTGCTGTCATGGAGGTTTATCTCGAGATAAACCTCCATGACAGCAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002710.x-715s1c1
Sequence:CCGGGCGAATTATGCGACCAACTGACTCGAGTCAGTTGGTCGCATAATTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002710.x-830s1c1
Sequence:CCGGACATTTGGTGCAGAAGTGGTTCTCGAGAACCACTTCTGCACCAAATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013636
PPP1CC MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, catalytic subunit, gamma isozyme
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-529s21c1
Sequence:CCGGCCAGAGAGCAACTATTTGTTTCTCGAGAAACAAATAGTTGCTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-1146s21c1
Sequence:CCGGCCTCATGTGTTCCTTCCAGATCTCGAGATCTGGAAGGAACACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-856s21c1
Sequence:CCGGCCAACTGATGTACCAGATCAACTCGAGTTGATCTGGTACATCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-663s21c1
Sequence:CCGGCGCCAGCATCAATAGGATCTACTCGAGTAGATCCTATTGATGCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-664s1c1
Sequence:CCGGCGCCAGCATCAATAGGATCTACTCGAGTAGATCCTATTGATGCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-1147s1c1
Sequence:CCGGCCTCATGTGTTCCTTCCAGATCTCGAGATCTGGAAGGAACACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-857s1c1
Sequence:CCGGCCAACTGATGTACCAGATCAACTCGAGTTGATCTGGTACATCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-530s1c1
Sequence:CCGGCCAGAGAGCAACTATTTGTTTCTCGAGAAACAAATAGTTGCTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013636
PPP1CC MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, catalytic subunit, gamma isozyme
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-529s21c1
Sequence:CCGGCCAGAGAGCAACTATTTGTTTCTCGAGAAACAAATAGTTGCTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-1146s21c1
Sequence:CCGGCCTCATGTGTTCCTTCCAGATCTCGAGATCTGGAAGGAACACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-856s21c1
Sequence:CCGGCCAACTGATGTACCAGATCAACTCGAGTTGATCTGGTACATCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-663s21c1
Sequence:CCGGCGCCAGCATCAATAGGATCTACTCGAGTAGATCCTATTGATGCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-664s1c1
Sequence:CCGGCGCCAGCATCAATAGGATCTACTCGAGTAGATCCTATTGATGCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-1147s1c1
Sequence:CCGGCCTCATGTGTTCCTTCCAGATCTCGAGATCTGGAAGGAACACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-857s1c1
Sequence:CCGGCCAACTGATGTACCAGATCAACTCGAGTTGATCTGGTACATCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-530s1c1
Sequence:CCGGCCAGAGAGCAACTATTTGTTTCTCGAGAAACAAATAGTTGCTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013636
PPP1CC MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, catalytic subunit, gamma isozyme
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-529s21c1
Sequence:CCGGCCAGAGAGCAACTATTTGTTTCTCGAGAAACAAATAGTTGCTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-1146s21c1
Sequence:CCGGCCTCATGTGTTCCTTCCAGATCTCGAGATCTGGAAGGAACACATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-856s21c1
Sequence:CCGGCCAACTGATGTACCAGATCAACTCGAGTTGATCTGGTACATCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013636.3-663s21c1
Sequence:CCGGCGCCAGCATCAATAGGATCTACTCGAGTAGATCCTATTGATGCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-664s1c1
Sequence:CCGGCGCCAGCATCAATAGGATCTACTCGAGTAGATCCTATTGATGCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-1147s1c1
Sequence:CCGGCCTCATGTGTTCCTTCCAGATCTCGAGATCTGGAAGGAACACATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-857s1c1
Sequence:CCGGCCAACTGATGTACCAGATCAACTCGAGTTGATCTGGTACATCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013636.2-530s1c1
Sequence:CCGGCCAGAGAGCAACTATTTGTTTCTCGAGAAACAAATAGTTGCTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)