EMAIL THIS PAGE TO A FRIEND

PPP1R10

protein phosphatase 1, regulatory subunit 10

132 Gene Product Result for
Synonyms: CAT53 FB19 PNUTS PP1R10 R111 p99
UniProtKB ID: Q96QC0, O00405
Gene ID:
Human(5514) Summary: This gene encodes a protein phosphatase 1 binding protein. The encoded protein plays a role in many cellular processes including cell cycle progression, DNA repair and apoptosis by regulating the activity of protein phosphatase 1. This gene lies within the major histocompatibility complex class I region on chromosome 6, and alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(52040) protein phosphatase 1, regulatory subunit 10
Rat(65045) protein phosphatase 1, regulatory subunit 10
domestic guinea pig(100720282) protein phosphatase 1, regulatory subunit 10
naked mole-rat(101708880) protein phosphatase 1, regulatory subunit 10
cow(510825) protein phosphatase 1, regulatory subunit 10
sheep(101105696) protein phosphatase 1, regulatory subunit 10
Zebrafish(192329) protein phosphatase 1, regulatory subunit 10
chicken(777176) protein phosphatase 1, regulatory (inhibitor) subunit 10
domestic cat(101092853) protein phosphatase 1, regulatory subunit 10
dog(481705) protein phosphatase 1, regulatory subunit 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002714 Rosetta Predictions human pricing
NM_022951 Rosetta Predictions rat pricing
NM_175934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133264 predicted 1791
2 SASI_Hs01_00133265 predicted 888
3 SASI_Hs01_00133266 predicted 1825
4 SASI_Hs01_00133267 predicted 918
5 SASI_Hs02_00334304 predicted 1828
6 SASI_Hs01_00133269 predicted 1164
7 SASI_Hs01_00133270 predicted 933
8 SASI_Hs01_00133271 predicted 3429
9 SASI_Hs02_00334305 predicted 2222
10 SASI_Hs01_00133273 predicted 2304
11 SASI_Hs01_00133268 predicted 789
12 SASI_Hs01_00133272 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113178 predicted 769
2 SASI_Rn01_00113179 predicted 1735
3 SASI_Rn01_00113180 predicted 2316
4 SASI_Rn02_00263684 predicted 1879
5 SASI_Rn01_00113181 predicted 757
6 SASI_Rn01_00113182 predicted 909
7 SASI_Rn01_00113183 predicted 905
8 SASI_Rn01_00113184 predicted 1805
9 SASI_Rn01_00113185 predicted 2900
10 SASI_Rn01_00113186 predicted 744
11 SASI_Rn01_00113187 predicted 2278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181045 predicted 791
2 SASI_Mm01_00181047 predicted 1155
3 SASI_Mm01_00181048 predicted 1339
4 SASI_Mm01_00181049 predicted 1842
5 SASI_Mm01_00181050 predicted 711
6 SASI_Mm01_00181051 predicted 2290
7 SASI_Mm01_00181054 predicted 2103
8 SASI_Mm02_00346688 predicted 2974
9 SASI_Mm02_00346689 predicted 2209
10 SASI_Mm02_00346690 predicted 2812
11 SASI_Mm01_00181046 predicted 1903
12 SASI_Mm01_00181052 predicted 1832
13 SASI_Mm01_00181053 predicted 2355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002714
PPP1R10 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 10
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1764s21c1
Sequence:CCGGAGGCAAACTGAGAGAATATTTCTCGAGAAATATTCTCTCAGTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1345s21c1
Sequence:CCGGCCACTCAACACAACACCTAATCTCGAGATTAGGTGTTGTGTTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-728s21c1
Sequence:CCGGCACCAGAAATATTGGTCAAATCTCGAGATTTGACCAATATTTCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002714.2-3668s21c1
Sequence:CCGGCTTTCCAGTATTACCCTTAATCTCGAGATTAAGGGTAATACTGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-752s21c1
Sequence:CCGGTTGACGTTGGCGGCTACAAACCTCGAGGTTTGTAGCCGCCAACGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-776s21c1
Sequence:CCGGTTAACAATTGGCTGACGTATTCTCGAGAATACGTCAGCCAATTGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1249s21c1
Sequence:CCGGTCTGACAAGTACAACCTTAAACTCGAGTTTAAGGTTGTACTTGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1797s21c1
Sequence:CCGGGGATGAAACTGAACGAGTAAACTCGAGTTTACTCGTTCAGTTTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002714.x-3941s1c1
Sequence:CCGGCCATTCTTAGTCCTTTCTCAACTCGAGTTGAGAAAGGACTAAGAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-762s1c1
Sequence:CCGGCGGCTACAAACTTCTTAACAACTCGAGTTGTTAAGAAGTTTGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-2352s21c1
Sequence:CCGGACTGAAACAACCAGACTATTCCTCGAGGAATAGTCTGGTTGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002714.2-3873s21c1
Sequence:CCGGGGGCTCAATCAGCTGGATTTGCTCGAGCAAATCCAGCTGATTGAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-692s21c1
Sequence:CCGGGATGCACTTACTTGAACATTCCTCGAGGAATGTTCAAGTAAGTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-2217s21c1
Sequence:CCGGTCCAGTTCTGGCCAATCTTATCTCGAGATAAGATTGGCCAGAACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-1344s1c1
Sequence:CCGGGCCACTCAACACAACACCTAACTCGAGTTAGGTGTTGTGTTGAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-1762s1c1
Sequence:CCGGGAAGGCAAACTGAGAGAATATCTCGAGATATTCTCTCAGTTTGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1986s21c1
Sequence:CCGGCAATAGTCAGGAGCGATATATCTCGAGATATATCGCTCCTGACTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002714
PPP1R10 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 10
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1764s21c1
Sequence:CCGGAGGCAAACTGAGAGAATATTTCTCGAGAAATATTCTCTCAGTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1345s21c1
Sequence:CCGGCCACTCAACACAACACCTAATCTCGAGATTAGGTGTTGTGTTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-728s21c1
Sequence:CCGGCACCAGAAATATTGGTCAAATCTCGAGATTTGACCAATATTTCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002714.2-3668s21c1
Sequence:CCGGCTTTCCAGTATTACCCTTAATCTCGAGATTAAGGGTAATACTGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-752s21c1
Sequence:CCGGTTGACGTTGGCGGCTACAAACCTCGAGGTTTGTAGCCGCCAACGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-776s21c1
Sequence:CCGGTTAACAATTGGCTGACGTATTCTCGAGAATACGTCAGCCAATTGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1249s21c1
Sequence:CCGGTCTGACAAGTACAACCTTAAACTCGAGTTTAAGGTTGTACTTGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1797s21c1
Sequence:CCGGGGATGAAACTGAACGAGTAAACTCGAGTTTACTCGTTCAGTTTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002714.x-3941s1c1
Sequence:CCGGCCATTCTTAGTCCTTTCTCAACTCGAGTTGAGAAAGGACTAAGAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-762s1c1
Sequence:CCGGCGGCTACAAACTTCTTAACAACTCGAGTTGTTAAGAAGTTTGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-2352s21c1
Sequence:CCGGACTGAAACAACCAGACTATTCCTCGAGGAATAGTCTGGTTGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002714.2-3873s21c1
Sequence:CCGGGGGCTCAATCAGCTGGATTTGCTCGAGCAAATCCAGCTGATTGAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-692s21c1
Sequence:CCGGGATGCACTTACTTGAACATTCCTCGAGGAATGTTCAAGTAAGTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-2217s21c1
Sequence:CCGGTCCAGTTCTGGCCAATCTTATCTCGAGATAAGATTGGCCAGAACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-1344s1c1
Sequence:CCGGGCCACTCAACACAACACCTAACTCGAGTTAGGTGTTGTGTTGAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-1762s1c1
Sequence:CCGGGAAGGCAAACTGAGAGAATATCTCGAGATATTCTCTCAGTTTGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1986s21c1
Sequence:CCGGCAATAGTCAGGAGCGATATATCTCGAGATATATCGCTCCTGACTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002714
PPP1R10 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 10
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1764s21c1
Sequence:CCGGAGGCAAACTGAGAGAATATTTCTCGAGAAATATTCTCTCAGTTTGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1345s21c1
Sequence:CCGGCCACTCAACACAACACCTAATCTCGAGATTAGGTGTTGTGTTGAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-728s21c1
Sequence:CCGGCACCAGAAATATTGGTCAAATCTCGAGATTTGACCAATATTTCTGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002714.2-3668s21c1
Sequence:CCGGCTTTCCAGTATTACCCTTAATCTCGAGATTAAGGGTAATACTGGAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-752s21c1
Sequence:CCGGTTGACGTTGGCGGCTACAAACCTCGAGGTTTGTAGCCGCCAACGTCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-776s21c1
Sequence:CCGGTTAACAATTGGCTGACGTATTCTCGAGAATACGTCAGCCAATTGTTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1249s21c1
Sequence:CCGGTCTGACAAGTACAACCTTAAACTCGAGTTTAAGGTTGTACTTGTCAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1797s21c1
Sequence:CCGGGGATGAAACTGAACGAGTAAACTCGAGTTTACTCGTTCAGTTTCATCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002714.x-3941s1c1
Sequence:CCGGCCATTCTTAGTCCTTTCTCAACTCGAGTTGAGAAAGGACTAAGAATGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-762s1c1
Sequence:CCGGCGGCTACAAACTTCTTAACAACTCGAGTTGTTAAGAAGTTTGTAGCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000368379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-2352s21c1
Sequence:CCGGACTGAAACAACCAGACTATTCCTCGAGGAATAGTCTGGTTGTTTCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002714.2-3873s21c1
Sequence:CCGGGGGCTCAATCAGCTGGATTTGCTCGAGCAAATCCAGCTGATTGAGCCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-692s21c1
Sequence:CCGGGATGCACTTACTTGAACATTCCTCGAGGAATGTTCAAGTAAGTGCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000364100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-2217s21c1
Sequence:CCGGTCCAGTTCTGGCCAATCTTATCTCGAGATAAGATTGGCCAGAACTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-1344s1c1
Sequence:CCGGGCCACTCAACACAACACCTAACTCGAGTTAGGTGTTGTGTTGAGTGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002714.x-1762s1c1
Sequence:CCGGGAAGGCAAACTGAGAGAATATCTCGAGATATTCTCTCAGTTTGCCTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002714.2-1986s21c1
Sequence:CCGGCAATAGTCAGGAGCGATATATCTCGAGATATATCGCTCCTGACTATTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175934
PPP1R10 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175934.2-3694s1c1
Sequence:CCGGCCAGTCACTGTTGAGTCCTTTCTCGAGAAAGGACTCAACAGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-2117s1c1
Sequence:CCGGGCCATGGATGAGACTCCATATCTCGAGATATGGAGTCTCATCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-677s1c1
Sequence:CCGGCGGTGCACGTACTTGAACATACTCGAGTATGTTCAAGTACGTGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-2063s1c1
Sequence:CCGGCCTGAGCCATATGAACCCATTCTCGAGAATGGGTTCATATGGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-724s1c1
Sequence:CCGGGCTCGTCAAGTTTATTGATGTCTCGAGACATCAATAAACTTGACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175934
PPP1R10 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175934.2-3694s1c1
Sequence:CCGGCCAGTCACTGTTGAGTCCTTTCTCGAGAAAGGACTCAACAGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-2117s1c1
Sequence:CCGGGCCATGGATGAGACTCCATATCTCGAGATATGGAGTCTCATCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-677s1c1
Sequence:CCGGCGGTGCACGTACTTGAACATACTCGAGTATGTTCAAGTACGTGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-2063s1c1
Sequence:CCGGCCTGAGCCATATGAACCCATTCTCGAGAATGGGTTCATATGGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-724s1c1
Sequence:CCGGGCTCGTCAAGTTTATTGATGTCTCGAGACATCAATAAACTTGACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175934
PPP1R10 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175934.2-3694s1c1
Sequence:CCGGCCAGTCACTGTTGAGTCCTTTCTCGAGAAAGGACTCAACAGTGACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-2117s1c1
Sequence:CCGGGCCATGGATGAGACTCCATATCTCGAGATATGGAGTCTCATCCATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-677s1c1
Sequence:CCGGCGGTGCACGTACTTGAACATACTCGAGTATGTTCAAGTACGTGCACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-2063s1c1
Sequence:CCGGCCTGAGCCATATGAACCCATTCTCGAGAATGGGTTCATATGGCTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175934.2-724s1c1
Sequence:CCGGGCTCGTCAAGTTTATTGATGTCTCGAGACATCAATAAACTTGACGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???