EMAIL THIS PAGE TO A FRIEND

PPP1R11

protein phosphatase 1, regulatory (inhibitor) subunit 11

183 Gene Product Result for
Synonyms: HCG-V HCGV IPP3 TCTE5 TCTEX5
UniProtKB ID: O60927
Gene ID:
Human(6992) Summary: This gene encodes a specific inhibitor of protein phosphatase-1 (PP1) with a differential sensitivity toward the metal-independent and metal-dependent forms of PP1. The gene is located within the major histocompatibility complex class I region on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(76497) protein phosphatase 1, regulatory (inhibitor) subunit 11
Rat(294207) protein phosphatase 1, regulatory (inhibitor) subunit 11
Zebrafish(550290) protein phosphatase 1, regulatory (inhibitor) subunit 11
domestic cat(101096890) protein phosphatase 1, regulatory (inhibitor) subunit 11
dog(608919) protein phosphatase 1, regulatory (inhibitor) subunit 11
cow(504846) protein phosphatase 1, regulatory (inhibitor) subunit 11
sheep(101112519) protein phosphatase 1, regulatory (inhibitor) subunit 11
naked mole-rat(101716942) protein phosphatase 1, regulatory (inhibitor) subunit 11
domestic guinea pig(100735037) protein phosphatase 1, regulatory (inhibitor) subunit 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021959 siRNAs that have been validated in the lab human pricing
NM_170781 Rosetta Predictions human pricing
NM_212542 Rosetta Predictions rat pricing
NM_029632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021959 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149137 validated 1017
1 SASI_Hs01_00149136 validated 1040
1 SASI_Hs01_00149135 validated 902
2 SASI_Hs01_00149142 predicted 429
3 SASI_Hs01_00149138 predicted 961
4 SASI_Hs01_00149139 predicted 1113
5 SASI_Hs01_00149143 predicted 284
6 SASI_Hs01_00149144 predicted 658
7 SASI_Hs01_00149140 predicted 905
8 SASI_Hs02_00355298 predicted 744
9 SASI_Hs02_00355299 predicted 295
10 SASI_Hs01_00149141 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059834 predicted 458
2 SASI_Hs01_00059835 predicted 681
3 SASI_Hs01_00059836 predicted 234
4 SASI_Hs01_00059837 predicted 288
5 SASI_Hs01_00059838 predicted 689
6 SASI_Hs01_00059839 predicted 249
7 SASI_Hs01_00059840 predicted 768
8 SASI_Hs01_00059841 predicted 291
9 SASI_Hs01_00059842 predicted 700
10 SASI_Hs01_00059843 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270563 predicted 237
2 SASI_Rn02_00270564 predicted 284
3 SASI_Rn01_00069846 predicted 209
4 SASI_Rn02_00270565 predicted 220
5 SASI_Rn01_00069847 predicted 932
6 SASI_Rn01_00069848 predicted 891
7 SASI_Rn01_00069849 predicted 451
8 SASI_Rn02_00270566 predicted 210
9 SASI_Rn01_00069850 predicted 306
10 SASI_Rn01_00069851 predicted 206
11 SASI_Rn01_00069843 predicted 259
12 SASI_Rn01_00069844 predicted 813
13 SASI_Rn01_00069845 predicted 575
14 SASI_Rn01_00069852 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335624 predicted 1056
2 SASI_Mm01_00032273 predicted 375
3 SASI_Mm01_00032277 predicted 413
4 SASI_Mm01_00032278 predicted 459
5 SASI_Mm01_00032279 predicted 327
6 SASI_Mm02_00335625 predicted 816
7 SASI_Mm01_00032281 predicted 363
8 SASI_Mm01_00032282 predicted 470
9 SASI_Mm02_00335626 predicted 431
10 SASI_Mm02_00335627 predicted 302
11 SASI_Mm01_00032274 predicted 240
12 SASI_Mm01_00032275 predicted 207
13 SASI_Mm01_00032276 predicted 266
14 SASI_Mm01_00032280 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021959
VALIDATED
PPP1R11 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-325s21c1
Sequence:CCGGCGAGAACCGGAGCCTTACCATCTCGAGATGGTAAGGCTCCGGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-979s1c1
Sequence:CCGGGCCCTAACTTTGCTTGCTAATCTCGAGATTAGCAAGCAAAGTTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021959.x-268s1c1
Sequence:CCGGCGAGAACCGGAGCCTTACCATCTCGAGATGGTAAGGCTCCGGTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-559s1c1
Sequence:CCGGTCCAGGGCCAATGCAGCACTACTCGAGTAGTGCTGCATTGGCCCTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-280s1c1
Sequence:CCGGCCTTACCATCAAACTTCGGAACTCGAGTTCCGAAGTTTGATGGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-281s1c1
Sequence:CCGGCTTACCATCAAACTTCGGAAACTCGAGTTTCCGAAGTTTGATGGTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021959.2-616s21c1
Sequence:CCGGTCCAGGGCCAATGCAGCACTACTCGAGTAGTGCTGCATTGGCCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-389s21c1
Sequence:GTACCGGAGTGACACTGTGGACAATGAACTCGAGTTCATTGTCCACAGTGTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-1036s21c1
Sequence:CCGGGCCCTAACTTTGCTTGCTAATCTCGAGATTAGCAAGCAAAGTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-499s21c1
Sequence:GTACCGGAGAAGAGGGCTGTGGTCATACCTCGAGGTATGACCACAGCCCTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-337s21c1
Sequence:CCGGCCTTACCATCAAACTTCGGAACTCGAGTTCCGAAGTTTGATGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021959
VALIDATED
PPP1R11 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-325s21c1
Sequence:CCGGCGAGAACCGGAGCCTTACCATCTCGAGATGGTAAGGCTCCGGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-979s1c1
Sequence:CCGGGCCCTAACTTTGCTTGCTAATCTCGAGATTAGCAAGCAAAGTTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021959.x-268s1c1
Sequence:CCGGCGAGAACCGGAGCCTTACCATCTCGAGATGGTAAGGCTCCGGTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-559s1c1
Sequence:CCGGTCCAGGGCCAATGCAGCACTACTCGAGTAGTGCTGCATTGGCCCTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-280s1c1
Sequence:CCGGCCTTACCATCAAACTTCGGAACTCGAGTTCCGAAGTTTGATGGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-281s1c1
Sequence:CCGGCTTACCATCAAACTTCGGAAACTCGAGTTTCCGAAGTTTGATGGTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021959.2-616s21c1
Sequence:CCGGTCCAGGGCCAATGCAGCACTACTCGAGTAGTGCTGCATTGGCCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-389s21c1
Sequence:GTACCGGAGTGACACTGTGGACAATGAACTCGAGTTCATTGTCCACAGTGTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-1036s21c1
Sequence:CCGGGCCCTAACTTTGCTTGCTAATCTCGAGATTAGCAAGCAAAGTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-499s21c1
Sequence:GTACCGGAGAAGAGGGCTGTGGTCATACCTCGAGGTATGACCACAGCCCTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-337s21c1
Sequence:CCGGCCTTACCATCAAACTTCGGAACTCGAGTTCCGAAGTTTGATGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021959
VALIDATED
PPP1R11 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-325s21c1
Sequence:CCGGCGAGAACCGGAGCCTTACCATCTCGAGATGGTAAGGCTCCGGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-979s1c1
Sequence:CCGGGCCCTAACTTTGCTTGCTAATCTCGAGATTAGCAAGCAAAGTTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021959.x-268s1c1
Sequence:CCGGCGAGAACCGGAGCCTTACCATCTCGAGATGGTAAGGCTCCGGTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-559s1c1
Sequence:CCGGTCCAGGGCCAATGCAGCACTACTCGAGTAGTGCTGCATTGGCCCTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-280s1c1
Sequence:CCGGCCTTACCATCAAACTTCGGAACTCGAGTTCCGAAGTTTGATGGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021959.x-281s1c1
Sequence:CCGGCTTACCATCAAACTTCGGAAACTCGAGTTTCCGAAGTTTGATGGTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021959.2-616s21c1
Sequence:CCGGTCCAGGGCCAATGCAGCACTACTCGAGTAGTGCTGCATTGGCCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-389s21c1
Sequence:GTACCGGAGTGACACTGTGGACAATGAACTCGAGTTCATTGTCCACAGTGTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-1036s21c1
Sequence:CCGGGCCCTAACTTTGCTTGCTAATCTCGAGATTAGCAAGCAAAGTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-499s21c1
Sequence:GTACCGGAGAAGAGGGCTGTGGTCATACCTCGAGGTATGACCACAGCCCTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021959.2-337s21c1
Sequence:CCGGCCTTACCATCAAACTTCGGAACTCGAGTTCCGAAGTTTGATGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029632
VALIDATED
PPP1R11 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-278s1c1
Sequence:CCGGGCCTAACTATGAAACTTCGGACTCGAGTCCGAAGTTTCATAGTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-398s21c1
Sequence:CCGGGAAACGCAAGCCAGAGAAGAACTCGAGTTCTTCTCTGGCTTGCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-265s1c1
Sequence:CCGGCCAGAGAATCAGAGCCTAACTCTCGAGAGTTAGGCTCTGATTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-297s1c1
Sequence:CCGGGAAACGCAAGCCAGAGAAGAACTCGAGTTCTTCTCTGGCTTGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-439s1c1
Sequence:CCGGGAAGAAGAAGGCTGTAGTCATCTCGAGATGACTACAGCCTTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-366s1c1
Sequence:CCGGCTCGTCGAAATGCTGCTGTATCTCGAGATACAGCAGCATTTCGACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-540s21c1
Sequence:CCGGGAAGAAGAAGGCTGTAGTCATCTCGAGATGACTACAGCCTTCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-366s21c1
Sequence:CCGGCCAGAGAATCAGAGCCTAACTCTCGAGAGTTAGGCTCTGATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-379s21c1
Sequence:CCGGGCCTAACTATGAAACTTCGGACTCGAGTCCGAAGTTTCATAGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029632
VALIDATED
PPP1R11 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-278s1c1
Sequence:CCGGGCCTAACTATGAAACTTCGGACTCGAGTCCGAAGTTTCATAGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-398s21c1
Sequence:CCGGGAAACGCAAGCCAGAGAAGAACTCGAGTTCTTCTCTGGCTTGCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-265s1c1
Sequence:CCGGCCAGAGAATCAGAGCCTAACTCTCGAGAGTTAGGCTCTGATTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-297s1c1
Sequence:CCGGGAAACGCAAGCCAGAGAAGAACTCGAGTTCTTCTCTGGCTTGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-439s1c1
Sequence:CCGGGAAGAAGAAGGCTGTAGTCATCTCGAGATGACTACAGCCTTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-366s1c1
Sequence:CCGGCTCGTCGAAATGCTGCTGTATCTCGAGATACAGCAGCATTTCGACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-540s21c1
Sequence:CCGGGAAGAAGAAGGCTGTAGTCATCTCGAGATGACTACAGCCTTCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-366s21c1
Sequence:CCGGCCAGAGAATCAGAGCCTAACTCTCGAGAGTTAGGCTCTGATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-379s21c1
Sequence:CCGGGCCTAACTATGAAACTTCGGACTCGAGTCCGAAGTTTCATAGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029632
VALIDATED
PPP1R11 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-278s1c1
Sequence:CCGGGCCTAACTATGAAACTTCGGACTCGAGTCCGAAGTTTCATAGTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-398s21c1
Sequence:CCGGGAAACGCAAGCCAGAGAAGAACTCGAGTTCTTCTCTGGCTTGCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-265s1c1
Sequence:CCGGCCAGAGAATCAGAGCCTAACTCTCGAGAGTTAGGCTCTGATTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-297s1c1
Sequence:CCGGGAAACGCAAGCCAGAGAAGAACTCGAGTTCTTCTCTGGCTTGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-439s1c1
Sequence:CCGGGAAGAAGAAGGCTGTAGTCATCTCGAGATGACTACAGCCTTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029632.1-366s1c1
Sequence:CCGGCTCGTCGAAATGCTGCTGTATCTCGAGATACAGCAGCATTTCGACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-540s21c1
Sequence:CCGGGAAGAAGAAGGCTGTAGTCATCTCGAGATGACTACAGCCTTCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-366s21c1
Sequence:CCGGCCAGAGAATCAGAGCCTAACTCTCGAGAGTTAGGCTCTGATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029632.2-379s21c1
Sequence:CCGGGCCTAACTATGAAACTTCGGACTCGAGTCCGAAGTTTCATAGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)