EMAIL THIS PAGE TO A FRIEND

PPP1R12A

protein phosphatase 1, regulatory subunit 12A

137 Gene Product Result for
Synonyms: M130 MBS MYPT1
Gene ID:
Human(4659) Summary: Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(17931) protein phosphatase 1, regulatory (inhibitor) subunit 12A
Rat(116670) protein phosphatase 1, regulatory subunit 12A
Zebrafish(445393) protein phosphatase 1, regulatory (inhibitor) subunit 12A
Horse(100060501) protein phosphatase 1, regulatory subunit 12A
domestic cat(101089624) protein phosphatase 1, regulatory subunit 12A
dog(475411) protein phosphatase 1, regulatory subunit 12A
chicken(396020) protein phosphatase 1, regulatory subunit 12A
domestic guinea pig(100727982) protein phosphatase 1, regulatory subunit 12A
naked mole-rat(101700150) protein phosphatase 1, regulatory subunit 12A
Domestic Rabbit(100350558) protein phosphatase 1, regulatory subunit 12A
cow(538606) protein phosphatase 1, regulatory subunit 12A
sheep(641303) protein phosphatase 1, regulatory subunit 12A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
07-672-I Anti-MYPT1 Antibody clone, from rabbit, purified by affinity chromatography human, human
immunoprecipitation (IP), western blot pricing
SAB4501948 Anti-MYPT1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501949 Anti-MYPT1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503944 Anti-phospho-MYPT1 (pThr853) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
07-1507 Anti-phospho-Mypt1 (Ser507) Antibody clone, from rabbit, purified by affinity chromatography chicken, mouse, human, bovine, mouse
western blot pricing
36-003 Anti-phospho-MYPT1 (Thr850) Antibody clone, Upstate®, from rabbit rat, human, chicken, mouse
western blot pricing
05-773 Anti-phospho-MYPT1 (Thr850) Antibody, clone SA19, rabbit monoclonal clone SA19, Upstate®, from rabbit chicken, human
western blot pricing
SAB5700445 Anti-Phospho-PPP1R12A-S507 antibody produced in rabbit New human
western blot pricing
SAB5700497 Anti-Phospho-PPP1R12A-S668 antibody produced in rabbit New mouse, human, rat
western blot pricing
SAB5700537 Anti-Phospho-PPP1R12A-T853 antibody produced in rabbit New mouse, rat, human
western blot pricing
SAB1100162 Anti-PPP1R12A (186-200) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100163 Anti-PPP1R12A (756-770) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA071956 Anti-PPP1R12A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA041296 Anti-PPP1R12A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA039443 Anti-PPP1R12A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002480 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002480 siRNAs that have been validated in the lab human pricing
NM_053890 Rosetta Predictions rat pricing
NM_027892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002480 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031160 validated 996
1 SASI_Hs01_00031159 validated 405
1 SASI_Hs01_00031161 validated 547
2 SASI_Hs01_00031162 predicted 1354
3 SASI_Hs01_00031163 predicted 414
4 SASI_Hs01_00031164 predicted 787
5 SASI_Hs01_00031166 predicted 234
6 SASI_Hs01_00031167 predicted 1831
7 SASI_Hs01_00031168 predicted 619
8 SASI_Hs02_00333910 predicted 1870
9 SASI_Hs02_00333911 predicted 1232
10 SASI_Hs01_00031165 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081295 predicted 2839
2 SASI_Rn01_00081296 predicted 2949
3 SASI_Rn02_00266810 predicted 1417
4 SASI_Rn01_00081297 predicted 2720
5 SASI_Rn01_00081298 predicted 511
6 SASI_Rn01_00081299 predicted 474
7 SASI_Rn01_00081300 predicted 438
8 SASI_Rn01_00081301 predicted 1398
9 SASI_Rn01_00081302 predicted 573
10 SASI_Rn01_00081303 predicted 2673
11 SASI_Rn01_00081304 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201427 predicted 3045
2 SASI_Mm01_00201428 predicted 417
3 SASI_Mm01_00201429 predicted 2751
4 SASI_Mm01_00201430 predicted 1623
5 SASI_Mm01_00201431 predicted 2982
6 SASI_Mm01_00201432 predicted 1828
7 SASI_Mm01_00201433 predicted 293
8 SASI_Mm01_00201434 predicted 1695
9 SASI_Mm01_00201435 predicted 402
10 SASI_Mm02_00332861 predicted 3084
11 SASI_Mm01_00201436 predicted 2725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002480
VALIDATED
PPP1R12A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 12A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-1481s21c1
Sequence:CCGGCAACACCTACATCACCTATTACTCGAGTAATAGGTGATGTAGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-2373s21c1
Sequence:CCGGGTATGCTTCAAGTCAACTAAACTCGAGTTTAGTTGACTTGAAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-2288s21c1
Sequence:CCGGATGAGACTTACCAGCGTTATACTCGAGTATAACGCTGGTAAGTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-1564s21c1
Sequence:CCGGTTGCGAACAAGTAGTTCATATCTCGAGATATGAACTACTTGTTCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-551s21c1
Sequence:CCGGGGCTAAATAGTGGTCATATAACTCGAGTTATATGACCACTATTTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002480.2-3641s21c1
Sequence:CCGGTTTACAGCTCCAGCATATAAGCTCGAGCTTATATGCTGGAGCTGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-502s1c1
Sequence:CCGGGCAGCTCGAAAGGAAGAAGAACTCGAGTTCTTCTTCCTTTCGAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-3130s21c1
Sequence:CCGGATGGAACTAACAGATCTTAAACTCGAGTTTAAGATCTGTTAGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002480.x-1772s1c1
Sequence:CCGGGCACTACTACAAAGATTACAACTCGAGTTGTAATCTTTGTAGTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-3381s1c1
Sequence:CCGGCCAGCATATAAGGAAAGTGTTCTCGAGAACACTTTCCTTATATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-802s1c1
Sequence:CCGGGCCTTTGATGTAGCAGATGAACTCGAGTTCATCTGCTACATCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-2276s1c1
Sequence:CCGGCCAGAACGTATGATGAGACTTCTCGAGAAGTCTCATCATACGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-1899s21c1
Sequence:CCGGTGAAGGATCAACGTATCATAACTCGAGTTATGATACGTTGATCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-3132s21c1
Sequence:CCGGGTAACCCAGTGGACCATAATTCTCGAGAATTATGGTCCACTGGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002480
VALIDATED
PPP1R12A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 12A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-1481s21c1
Sequence:CCGGCAACACCTACATCACCTATTACTCGAGTAATAGGTGATGTAGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-2373s21c1
Sequence:CCGGGTATGCTTCAAGTCAACTAAACTCGAGTTTAGTTGACTTGAAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-2288s21c1
Sequence:CCGGATGAGACTTACCAGCGTTATACTCGAGTATAACGCTGGTAAGTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-1564s21c1
Sequence:CCGGTTGCGAACAAGTAGTTCATATCTCGAGATATGAACTACTTGTTCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-551s21c1
Sequence:CCGGGGCTAAATAGTGGTCATATAACTCGAGTTATATGACCACTATTTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002480.2-3641s21c1
Sequence:CCGGTTTACAGCTCCAGCATATAAGCTCGAGCTTATATGCTGGAGCTGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-502s1c1
Sequence:CCGGGCAGCTCGAAAGGAAGAAGAACTCGAGTTCTTCTTCCTTTCGAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-3130s21c1
Sequence:CCGGATGGAACTAACAGATCTTAAACTCGAGTTTAAGATCTGTTAGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002480.x-1772s1c1
Sequence:CCGGGCACTACTACAAAGATTACAACTCGAGTTGTAATCTTTGTAGTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-3381s1c1
Sequence:CCGGCCAGCATATAAGGAAAGTGTTCTCGAGAACACTTTCCTTATATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-802s1c1
Sequence:CCGGGCCTTTGATGTAGCAGATGAACTCGAGTTCATCTGCTACATCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-2276s1c1
Sequence:CCGGCCAGAACGTATGATGAGACTTCTCGAGAAGTCTCATCATACGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-1899s21c1
Sequence:CCGGTGAAGGATCAACGTATCATAACTCGAGTTATGATACGTTGATCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-3132s21c1
Sequence:CCGGGTAACCCAGTGGACCATAATTCTCGAGAATTATGGTCCACTGGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002480
VALIDATED
PPP1R12A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 12A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-1481s21c1
Sequence:CCGGCAACACCTACATCACCTATTACTCGAGTAATAGGTGATGTAGGTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-2373s21c1
Sequence:CCGGGTATGCTTCAAGTCAACTAAACTCGAGTTTAGTTGACTTGAAGCATACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-2288s21c1
Sequence:CCGGATGAGACTTACCAGCGTTATACTCGAGTATAACGCTGGTAAGTCTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-1564s21c1
Sequence:CCGGTTGCGAACAAGTAGTTCATATCTCGAGATATGAACTACTTGTTCGCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-551s21c1
Sequence:CCGGGGCTAAATAGTGGTCATATAACTCGAGTTATATGACCACTATTTAGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002480.2-3641s21c1
Sequence:CCGGTTTACAGCTCCAGCATATAAGCTCGAGCTTATATGCTGGAGCTGTAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-502s1c1
Sequence:CCGGGCAGCTCGAAAGGAAGAAGAACTCGAGTTCTTCTTCCTTTCGAGCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-3130s21c1
Sequence:CCGGATGGAACTAACAGATCTTAAACTCGAGTTTAAGATCTGTTAGTTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002480.x-1772s1c1
Sequence:CCGGGCACTACTACAAAGATTACAACTCGAGTTGTAATCTTTGTAGTAGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-3381s1c1
Sequence:CCGGCCAGCATATAAGGAAAGTGTTCTCGAGAACACTTTCCTTATATGCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-802s1c1
Sequence:CCGGGCCTTTGATGTAGCAGATGAACTCGAGTTCATCTGCTACATCAAAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_002480.x-2276s1c1
Sequence:CCGGCCAGAACGTATGATGAGACTTCTCGAGAAGTCTCATCATACGTTCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002480.2-1899s21c1
Sequence:CCGGTGAAGGATCAACGTATCATAACTCGAGTTATGATACGTTGATCCTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000231496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002480.1-3132s21c1
Sequence:CCGGGTAACCCAGTGGACCATAATTCTCGAGAATTATGGTCCACTGGGTTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027892
VALIDATED
PPP1R12A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 12A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2396s21c1
Sequence:CCGGCAAACAGTCTTGTAGGTATAACTCGAGTTATACCTACAAGACTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2283s21c1
Sequence:CCGGTGAGACTTACACACGTTATAGCTCGAGCTATAACGTGTGTAAGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-3084s21c1
Sequence:CCGGGAGCCTTGATCAGAGTTATAACTCGAGTTATAACTCTGATCAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-1427s21c1
Sequence:CCGGTCTCGTCCTCTTTGGATAATACTCGAGTATTATCCAAAGAGGACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2859s21c1
Sequence:CCGGTATGGAACTAACGGATCTAAACTCGAGTTTAGATCCGTTAGTTCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027892
VALIDATED
PPP1R12A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 12A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2396s21c1
Sequence:CCGGCAAACAGTCTTGTAGGTATAACTCGAGTTATACCTACAAGACTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2283s21c1
Sequence:CCGGTGAGACTTACACACGTTATAGCTCGAGCTATAACGTGTGTAAGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-3084s21c1
Sequence:CCGGGAGCCTTGATCAGAGTTATAACTCGAGTTATAACTCTGATCAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-1427s21c1
Sequence:CCGGTCTCGTCCTCTTTGGATAATACTCGAGTATTATCCAAAGAGGACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2859s21c1
Sequence:CCGGTATGGAACTAACGGATCTAAACTCGAGTTTAGATCCGTTAGTTCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027892
VALIDATED
PPP1R12A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 12A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2396s21c1
Sequence:CCGGCAAACAGTCTTGTAGGTATAACTCGAGTTATACCTACAAGACTGTTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2283s21c1
Sequence:CCGGTGAGACTTACACACGTTATAGCTCGAGCTATAACGTGTGTAAGTCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-3084s21c1
Sequence:CCGGGAGCCTTGATCAGAGTTATAACTCGAGTTATAACTCTGATCAAGGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-1427s21c1
Sequence:CCGGTCTCGTCCTCTTTGGATAATACTCGAGTATTATCCAAAGAGGACGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000240625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027892.2-2859s21c1
Sequence:CCGGTATGGAACTAACGGATCTAAACTCGAGTTTAGATCCGTTAGTTCCATATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???