EMAIL THIS PAGE TO A FRIEND

PPP1R12B

protein phosphatase 1, regulatory subunit 12B

213 Gene Product Result for
Synonyms: MYPT2 PP1bp55
Gene ID:
Human(4660) Summary: Myosin phosphatase is a protein complex comprised of three subunits: a catalytic subunit (PP1c-delta, protein phosphatase 1, catalytic subunit delta), a large regulatory subunit (MYPT, myosin phosphatase target) and small regulatory subunit (sm-M20). Two isoforms of MYPT have been isolated--MYPT1 and MYPT2, the first of which is widely expressed, and the second of which may be specific to heart, skeletal muscle, and brain. Each of the MYPT isoforms functions to bind PP1c-delta and increase phosphatase activity. This locus encodes both MYTP2 and M20. Alternatively spliced transcript variants encoding different isoforms have been identified. Related pseudogenes have been defined on the Y chromosome. [provided by RefSeq, Oct 2011]
Mouse(329251) protein phosphatase 1, regulatory (inhibitor) subunit 12B
Rat(304813) protein phosphatase 1, regulatory subunit 12B
cow(100337338) protein phosphatase 1, regulatory subunit 12B
sheep(101110859) protein phosphatase 1, regulatory subunit 12B
Domestic Rabbit(100356902) protein phosphatase 1, regulatory subunit 12B
naked mole-rat(101711489) protein phosphatase 1, regulatory subunit 12B
domestic guinea pig(100729743) protein phosphatase 1, regulatory subunit 12B
chicken(395478) protein phosphatase 1, regulatory subunit 12B
Horse(100063928) protein phosphatase 1, regulatory subunit 12B
domestic cat(101098766) protein phosphatase 1, regulatory subunit 12B
dog(490230) protein phosphatase 1, regulatory subunit 12B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094841 MISSION® esiRNA esiRNA human PPP1R12B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002481 Rosetta Predictions human pricing
NM_032103 Rosetta Predictions human pricing
NM_032104 Rosetta Predictions human pricing
NM_032105 Rosetta Predictions human pricing
NM_001107178 Rosetta Predictions rat pricing
NM_001081307 Rosetta Predictions mouse pricing
XM_136178 Rosetta Predictions mouse pricing
XM_889709 Rosetta Predictions mouse pricing
XM_898626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084274 predicted 3424
2 SASI_Hs01_00084275 predicted 3255
3 SASI_Hs01_00084276 predicted 2379
4 SASI_Hs01_00084277 predicted 3416
5 SASI_Hs01_00084278 predicted 3225
6 SASI_Hs01_00084279 predicted 3437
7 SASI_Hs01_00084281 predicted 2430
8 SASI_Hs01_00084282 predicted 2649
9 SASI_Hs02_00333912 predicted 2567
10 SASI_Hs01_00084283 predicted 2423
11 SASI_Hs01_00084280 predicted 2670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243759 predicted 1789
2 SASI_Hs01_00243760 predicted 1132
3 SASI_Hs02_00359289 predicted 913
4 SASI_Hs01_00243761 predicted 1772
5 SASI_Hs02_00359290 predicted 1587
6 SASI_Hs01_00243764 predicted 1803
7 SASI_Hs01_00243766 predicted 1012
8 SASI_Hs01_00243767 predicted 1570
9 SASI_Hs01_00243768 predicted 1799
10 SASI_Hs02_00359291 predicted 934
11 SASI_Hs01_00243762 predicted 965
12 SASI_Hs01_00243763 predicted 1770
13 SASI_Hs01_00243765 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235026 predicted 1963
2 SASI_Hs01_00235027 predicted 1127
3 SASI_Hs02_00359292 predicted 909
4 SASI_Hs01_00235028 predicted 1957
5 SASI_Hs02_00359293 predicted 1770
6 SASI_Hs01_00235031 predicted 1978
7 SASI_Hs01_00235033 predicted 1005
8 SASI_Hs01_00235034 predicted 1749
9 SASI_Hs01_00235035 predicted 1981
10 SASI_Hs02_00359294 predicted 927
11 SASI_Hs01_00235029 predicted 973
12 SASI_Hs01_00235030 predicted 1950
13 SASI_Hs01_00235032 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076952 predicted 3604
2 SASI_Hs01_00076953 predicted 3433
3 SASI_Hs01_00076954 predicted 2381
4 SASI_Hs01_00076955 predicted 3596
5 SASI_Hs01_00076956 predicted 3409
6 SASI_Hs01_00076957 predicted 3620
7 SASI_Hs01_00076959 predicted 2430
8 SASI_Hs01_00076960 predicted 2648
9 SASI_Hs02_00359295 predicted 2560
10 SASI_Hs01_00076961 predicted 2425
11 SASI_Hs01_00076958 predicted 2672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226275 predicted 1094
2 SASI_Rn02_00226276 predicted 975
3 SASI_Rn02_00226277 predicted 874
4 SASI_Rn02_00226278 predicted 2296
5 SASI_Rn02_00226279 predicted 566
6 SASI_Rn02_00226280 predicted 416
7 SASI_Rn02_00226281 predicted 2593
8 SASI_Rn02_00226282 predicted 453
9 SASI_Rn02_00226283 predicted 2461
10 SASI_Rn02_00226284 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297151 predicted 686
2 SASI_Mm02_00297152 predicted 858
3 SASI_Mm02_00297153 predicted 566
4 SASI_Mm02_00297154 predicted 1771
5 SASI_Mm02_00297155 predicted 1627
6 SASI_Mm02_00297156 predicted 1706
7 SASI_Mm02_00297157 predicted 618
8 SASI_Mm02_00297158 predicted 997
9 SASI_Mm02_00297159 predicted 1492
10 SASI_Mm02_00297160 predicted 2457
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280604 predicted 695
2 SASI_Mm01_00280605 predicted 864
3 SASI_Mm01_00280606 predicted 566
4 SASI_Mm01_00280607 predicted 1780
5 SASI_Mm01_00280608 predicted 1627
6 SASI_Mm01_00280609 predicted 1718
7 SASI_Mm01_00280610 predicted 621
8 SASI_Mm01_00280611 predicted 993
9 SASI_Mm01_00280612 predicted 1498
10 SASI_Mm01_00280613 predicted 2459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228857 predicted 697
2 SASI_Mm01_00228858 predicted 864
3 SASI_Mm01_00228859 predicted 568
4 SASI_Mm01_00228860 predicted 1785
5 SASI_Mm01_00228861 predicted 1627
6 SASI_Mm01_00228862 predicted 1714
7 SASI_Mm01_00228863 predicted 619
8 SASI_Mm01_00228864 predicted 1000
9 SASI_Mm01_00228865 predicted 1497
10 SASI_Mm01_00228866 predicted 2458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253618 predicted 342
2 SASI_Mm01_00253619 predicted 391
3 SASI_Mm01_00253620 predicted 334
4 SASI_Mm01_00253621 predicted 328
5 SASI_Mm01_00253622 predicted 801
6 SASI_Mm01_00253623 predicted 473
7 SASI_Mm01_00253624 predicted 616
8 SASI_Mm01_00253625 predicted 515
9 SASI_Mm01_00253626 predicted 360
10 SASI_Mm01_00253627 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002481
VALIDATED
PPP1R12B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 12B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-581s21c1
Sequence:CCGGACGGAGCCAGTGTAGGTATTGCTCGAGCAATACCTACACTGGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-5556s21c1
Sequence:CCGGTATCTTGAGACTTCGTATTATCTCGAGATAATACGAAGTCTCAAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-2855s21c1
Sequence:CCGGAGCTAGAGCTAGCAGATATAACTCGAGTTATATCTGCTAGCTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002481.2-1508s21c1
Sequence:CCGGCCAATTCCAGGGAACCTATAACTCGAGTTATAGGTTCCCTGGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002481.2-966s21c1
Sequence:CCGGTGACATGGATATTCGAAATAACTCGAGTTATTTCGAATATCCATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-1316s1c1
Sequence:CCGGCCAACTCTGAAAGCAAGAGTACTCGAGTACTCTTGCTTTCAGAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-2388s1c1
Sequence:CCGGCCTGCTATGGACAAATAGATTCTCGAGAATCTATTTGTCCATAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002481.2-7473s1c1
Sequence:CCGGCCGCACTTTAAGCACACACTTCTCGAGAAGTGTGTGCTTAAAGTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002481.2-2630s1c1
Sequence:CCGGCGTGGCATGAAAGACTTTCTACTCGAGTAGAAAGTCTTTCATGCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-1781s1c1
Sequence:CCGGCCTCCACCTATGTATCAACTTCTCGAGAAGTTGATACATAGGTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002481
VALIDATED
PPP1R12B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 12B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-581s21c1
Sequence:CCGGACGGAGCCAGTGTAGGTATTGCTCGAGCAATACCTACACTGGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-5556s21c1
Sequence:CCGGTATCTTGAGACTTCGTATTATCTCGAGATAATACGAAGTCTCAAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-2855s21c1
Sequence:CCGGAGCTAGAGCTAGCAGATATAACTCGAGTTATATCTGCTAGCTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002481.2-1508s21c1
Sequence:CCGGCCAATTCCAGGGAACCTATAACTCGAGTTATAGGTTCCCTGGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002481.2-966s21c1
Sequence:CCGGTGACATGGATATTCGAAATAACTCGAGTTATTTCGAATATCCATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-1316s1c1
Sequence:CCGGCCAACTCTGAAAGCAAGAGTACTCGAGTACTCTTGCTTTCAGAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-2388s1c1
Sequence:CCGGCCTGCTATGGACAAATAGATTCTCGAGAATCTATTTGTCCATAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002481.2-7473s1c1
Sequence:CCGGCCGCACTTTAAGCACACACTTCTCGAGAAGTGTGTGCTTAAAGTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002481.2-2630s1c1
Sequence:CCGGCGTGGCATGAAAGACTTTCTACTCGAGTAGAAAGTCTTTCATGCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-1781s1c1
Sequence:CCGGCCTCCACCTATGTATCAACTTCTCGAGAAGTTGATACATAGGTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002481
VALIDATED
PPP1R12B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 12B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-581s21c1
Sequence:CCGGACGGAGCCAGTGTAGGTATTGCTCGAGCAATACCTACACTGGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-5556s21c1
Sequence:CCGGTATCTTGAGACTTCGTATTATCTCGAGATAATACGAAGTCTCAAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002481.2-2855s21c1
Sequence:CCGGAGCTAGAGCTAGCAGATATAACTCGAGTTATATCTGCTAGCTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002481.2-1508s21c1
Sequence:CCGGCCAATTCCAGGGAACCTATAACTCGAGTTATAGGTTCCCTGGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002481.2-966s21c1
Sequence:CCGGTGACATGGATATTCGAAATAACTCGAGTTATTTCGAATATCCATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-1316s1c1
Sequence:CCGGCCAACTCTGAAAGCAAGAGTACTCGAGTACTCTTGCTTTCAGAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-2388s1c1
Sequence:CCGGCCTGCTATGGACAAATAGATTCTCGAGAATCTATTTGTCCATAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002481.2-7473s1c1
Sequence:CCGGCCGCACTTTAAGCACACACTTCTCGAGAAGTGTGTGCTTAAAGTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_002481.2-2630s1c1
Sequence:CCGGCGTGGCATGAAAGACTTTCTACTCGAGTAGAAAGTCTTTCATGCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002481.2-1781s1c1
Sequence:CCGGCCTCCACCTATGTATCAACTTCTCGAGAAGTTGATACATAGGTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136178
PPP1R12B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 12B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136178.5-4116s1c1
Sequence:CCGGGCATCTATAATCCCAGCACTTCTCGAGAAGTGCTGGGATTATAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-1830s1c1
Sequence:CCGGGCTGACTCAACAGCAGAGAAACTCGAGTTTCTCTGCTGTTGAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-2552s1c1
Sequence:CCGGCGGCATTAACTTCTGGACAAACTCGAGTTTGTCCAGAAGTTAATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-645s1c1
Sequence:CCGGCCAGCCATGAAAGACCTTCTTCTCGAGAAGAAGGTCTTTCATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-2286s1c1
Sequence:CCGGCGCCTAAGGTATCCAACTCAACTCGAGTTGAGTTGGATACCTTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136178
PPP1R12B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 12B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136178.5-4116s1c1
Sequence:CCGGGCATCTATAATCCCAGCACTTCTCGAGAAGTGCTGGGATTATAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-1830s1c1
Sequence:CCGGGCTGACTCAACAGCAGAGAAACTCGAGTTTCTCTGCTGTTGAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-2552s1c1
Sequence:CCGGCGGCATTAACTTCTGGACAAACTCGAGTTTGTCCAGAAGTTAATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-645s1c1
Sequence:CCGGCCAGCCATGAAAGACCTTCTTCTCGAGAAGAAGGTCTTTCATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-2286s1c1
Sequence:CCGGCGCCTAAGGTATCCAACTCAACTCGAGTTGAGTTGGATACCTTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136178
PPP1R12B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 12B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136178.5-4116s1c1
Sequence:CCGGGCATCTATAATCCCAGCACTTCTCGAGAAGTGCTGGGATTATAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-1830s1c1
Sequence:CCGGGCTGACTCAACAGCAGAGAAACTCGAGTTTCTCTGCTGTTGAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-2552s1c1
Sequence:CCGGCGGCATTAACTTCTGGACAAACTCGAGTTTGTCCAGAAGTTAATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-645s1c1
Sequence:CCGGCCAGCCATGAAAGACCTTCTTCTCGAGAAGAAGGTCTTTCATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136178.5-2286s1c1
Sequence:CCGGCGCCTAAGGTATCCAACTCAACTCGAGTTGAGTTGGATACCTTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)